DC-Build-Header: trinityrnaseq 2.2.0+dfsg-2 / 2017-07-06 17:41:18 +0000
DC-Task: type:rebuild-binarch-only source:trinityrnaseq version:2.2.0+dfsg-2 chroot:unstable esttime:986 logfile:/tmp/trinityrnaseq_2.2.0+dfsg-2_unstable_clang3.9.log modes:clang:binarch-only
DC-Sbuild-call: su user42 -c 'sbuild -n --arch-any --apt-update -d unstable -v  --chroot-setup-commands=/tmp/clang trinityrnaseq_2.2.0+dfsg-2'
sbuild (Debian sbuild) 0.73.0 (23 Dec 2016) on ip-172-31-43-157.eu-central-1.compute.internal

+==============================================================================+
| trinityrnaseq 2.2.0+dfsg-2 (amd64)           Thu, 06 Jul 2017 17:41:18 +0000 |
+==============================================================================+

Package: trinityrnaseq
Version: 2.2.0+dfsg-2
Source Version: 2.2.0+dfsg-2
Distribution: unstable
Machine Architecture: amd64
Host Architecture: amd64
Build Architecture: amd64
Build Type: any

I: NOTICE: Log filtering will replace 'var/run/schroot/mount/unstable-amd64-sbuild-37b827a9-8613-4432-bf06-218aed5415bb' with '<<CHROOT>>'

+------------------------------------------------------------------------------+
| Chroot Setup Commands                                                        |
+------------------------------------------------------------------------------+


/tmp/clang
----------

+ echo 'Entering customization script...'
Entering customization script...
+ CLANG_VERSION=3.9
+ echo 'Install of clang-3.9'
Install of clang-3.9
+ apt-get update
Get:1 http://127.0.0.1:9999/debian unstable InRelease [255 kB]
Get:2 http://127.0.0.1:9999/debian unstable/main Sources.diff/Index [27.9 kB]
Get:3 http://127.0.0.1:9999/debian unstable/main amd64 Packages.diff/Index [27.9 kB]
Get:4 http://127.0.0.1:9999/debian unstable/main Translation-en.diff/Index [27.9 kB]
Get:5 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-02-0216.39.pdiff [15.0 kB]
Get:6 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-02-0817.00.pdiff [7416 B]
Get:7 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-02-1415.16.pdiff [17.0 kB]
Get:8 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-02-2015.53.pdiff [15.2 kB]
Get:9 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-03-0215.43.pdiff [50.2 kB]
Get:10 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-03-0815.58.pdiff [5500 B]
Get:11 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-03-1420.59.pdiff [15.8 kB]
Get:12 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-03-2015.52.pdiff [15.6 kB]
Get:13 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-04-0215.56.pdiff [7165 B]
Get:14 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-04-0817.36.pdiff [8303 B]
Get:15 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-04-1416.28.pdiff [11.7 kB]
Get:16 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-04-2017.16.pdiff [12.7 kB]
Get:17 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-05-0215.45.pdiff [7714 B]
Get:18 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-05-0817.10.pdiff [6491 B]
Get:19 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-05-1416.09.pdiff [13.0 kB]
Get:20 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-05-2019.56.pdiff [14.2 kB]
Get:21 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-06-0216.07.pdiff [9132 B]
Get:22 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-06-0817.23.pdiff [16.8 kB]
Get:23 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-02-0216.39.pdiff [31.6 kB]
Get:24 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-02-0817.00.pdiff [12.0 kB]
Get:25 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-02-1415.16.pdiff [11.6 kB]
Get:26 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-02-2015.53.pdiff [12.9 kB]
Get:27 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-03-0215.43.pdiff [63.1 kB]
Get:28 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-03-0815.58.pdiff [23.3 kB]
Get:29 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-03-1420.59.pdiff [40.0 kB]
Get:30 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-03-2015.52.pdiff [28.4 kB]
Get:22 http://127.0.0.1:9999/debian unstable/main Sources 2017-07-06-0817.23.pdiff [16.8 kB]
Get:31 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-04-0215.56.pdiff [7447 B]
Get:32 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-04-0817.36.pdiff [5458 B]
Get:33 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-04-1416.28.pdiff [33.1 kB]
Get:34 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-04-2017.16.pdiff [18.8 kB]
Get:35 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-05-0215.45.pdiff [5901 B]
Get:36 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-05-0817.10.pdiff [15.3 kB]
Get:37 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-05-1416.09.pdiff [11.4 kB]
Get:38 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-05-2019.56.pdiff [13.0 kB]
Get:39 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-06-0216.07.pdiff [8638 B]
Get:40 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-06-0817.23.pdiff [31.2 kB]
Get:41 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-02-0216.39.pdiff [1271 B]
Get:42 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-02-2015.53.pdiff [793 B]
Get:43 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-03-0215.43.pdiff [327 B]
Get:44 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-03-0815.58.pdiff [270 B]
Get:45 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-03-1420.59.pdiff [1066 B]
Get:46 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-03-2015.52.pdiff [465 B]
Get:47 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-04-0215.56.pdiff [291 B]
Get:48 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-04-0817.36.pdiff [539 B]
Get:40 http://127.0.0.1:9999/debian unstable/main amd64 Packages 2017-07-06-0817.23.pdiff [31.2 kB]
Get:49 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-04-1416.28.pdiff [484 B]
Get:50 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-04-2017.16.pdiff [1126 B]
Get:51 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-05-0215.45.pdiff [214 B]
Get:52 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-05-0817.10.pdiff [606 B]
Get:53 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-05-1416.09.pdiff [214 B]
Get:54 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-05-2019.56.pdiff [2615 B]
Get:55 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-06-0216.07.pdiff [1869 B]
Get:56 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-06-0817.23.pdiff [915 B]
Get:56 http://127.0.0.1:9999/debian unstable/main Translation-en 2017-07-06-0817.23.pdiff [915 B]
Fetched 974 kB in 1s (811 kB/s)
Reading package lists...
+ apt-get install --yes --no-install-recommends --force-yes clang-3.9
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
  cpp-6 g++-6 gcc-6 gcc-6-base gcc-7-base libasan3 libatomic1 libbsd0 libcc1-0
  libcilkrts5 libclang-common-3.9-dev libclang1-3.9 libedit2 libffi6
  libgcc-6-dev libgcc1 libgomp1 libitm1 libjsoncpp1 libllvm3.9 liblsan0
  libmpx2 libncurses5 libobjc-6-dev libobjc4 libquadmath0 libstdc++-6-dev
  libstdc++6 libtsan0 libubsan0
Suggested packages:
  gnustep gnustep-devel clang-3.9-doc gcc-6-locales g++-6-multilib gcc-6-doc
  libstdc++6-6-dbg gcc-6-multilib libgcc1-dbg libgomp1-dbg libitm1-dbg
  libatomic1-dbg libasan3-dbg liblsan0-dbg libtsan0-dbg libubsan0-dbg
  libcilkrts5-dbg libmpx2-dbg libquadmath0-dbg libstdc++-6-doc
Recommended packages:
  llvm-3.9-dev python libgpm2
The following NEW packages will be installed:
  clang-3.9 libbsd0 libclang-common-3.9-dev libclang1-3.9 libedit2 libffi6
  libjsoncpp1 libllvm3.9 libncurses5 libobjc-6-dev libobjc4
The following packages will be upgraded:
  cpp-6 g++-6 gcc-6 gcc-6-base gcc-7-base libasan3 libatomic1 libcc1-0
  libcilkrts5 libgcc-6-dev libgcc1 libgomp1 libitm1 liblsan0 libmpx2
  libquadmath0 libstdc++-6-dev libstdc++6 libtsan0 libubsan0
20 upgraded, 11 newly installed, 0 to remove and 13 not upgraded.
Need to get 83.9 MB of archives.
After this operation, 251 MB of additional disk space will be used.
Get:1 http://127.0.0.1:9999/debian unstable/main amd64 libquadmath0 amd64 7.1.0-9 [132 kB]
Get:2 http://127.0.0.1:9999/debian unstable/main amd64 libitm1 amd64 7.1.0-9 [27.2 kB]
Get:3 http://127.0.0.1:9999/debian unstable/main amd64 gcc-7-base amd64 7.1.0-9 [180 kB]
Get:4 http://127.0.0.1:9999/debian unstable/main amd64 libstdc++6 amd64 7.1.0-9 [398 kB]
Get:5 http://127.0.0.1:9999/debian unstable/main amd64 libmpx2 amd64 7.1.0-9 [11.4 kB]
Get:6 http://127.0.0.1:9999/debian unstable/main amd64 liblsan0 amd64 7.1.0-9 [124 kB]
Get:7 http://127.0.0.1:9999/debian unstable/main amd64 libtsan0 amd64 7.1.0-9 [270 kB]
Get:8 http://127.0.0.1:9999/debian unstable/main amd64 libubsan0 amd64 7.1.0-9 [117 kB]
Get:9 http://127.0.0.1:9999/debian unstable/main amd64 libcilkrts5 amd64 7.1.0-9 [42.0 kB]
Get:10 http://127.0.0.1:9999/debian unstable/main amd64 libcc1-0 amd64 7.1.0-9 [37.7 kB]
Get:11 http://127.0.0.1:9999/debian unstable/main amd64 libatomic1 amd64 7.1.0-9 [8782 B]
Get:12 http://127.0.0.1:9999/debian unstable/main amd64 libgomp1 amd64 7.1.0-9 [75.1 kB]
Get:13 http://127.0.0.1:9999/debian unstable/main amd64 libgcc1 amd64 1:7.1.0-9 [39.3 kB]
Get:14 http://127.0.0.1:9999/debian unstable/main amd64 libasan3 amd64 6.4.0-1 [310 kB]
Get:15 http://127.0.0.1:9999/debian unstable/main amd64 g++-6 amd64 6.4.0-1 [7084 kB]
Get:16 http://127.0.0.1:9999/debian unstable/main amd64 libstdc++-6-dev amd64 6.4.0-1 [1421 kB]
Get:17 http://127.0.0.1:9999/debian unstable/main amd64 gcc-6 amd64 6.4.0-1 [6908 kB]
Get:18 http://127.0.0.1:9999/debian unstable/main amd64 libgcc-6-dev amd64 6.4.0-1 [2297 kB]
Get:19 http://127.0.0.1:9999/debian unstable/main amd64 cpp-6 amd64 6.4.0-1 [6549 kB]
Get:20 http://127.0.0.1:9999/debian unstable/main amd64 gcc-6-base amd64 6.4.0-1 [180 kB]
Get:21 http://127.0.0.1:9999/debian unstable/main amd64 libbsd0 amd64 0.8.5-1 [89.6 kB]
Get:22 http://127.0.0.1:9999/debian unstable/main amd64 libncurses5 amd64 6.0+20161126-1 [93.4 kB]
Get:23 http://127.0.0.1:9999/debian unstable/main amd64 libedit2 amd64 3.1-20170329-1 [85.2 kB]
Get:24 http://127.0.0.1:9999/debian unstable/main amd64 libffi6 amd64 3.2.1-6 [20.4 kB]
Get:25 http://127.0.0.1:9999/debian unstable/main amd64 libllvm3.9 amd64 1:3.9.1-10 [11.3 MB]
Get:26 http://127.0.0.1:9999/debian unstable/main amd64 libclang1-3.9 amd64 1:3.9.1-10 [5875 kB]
Get:27 http://127.0.0.1:9999/debian unstable/main amd64 libjsoncpp1 amd64 1.7.4-3 [75.6 kB]
Get:28 http://127.0.0.1:9999/debian unstable/main amd64 libobjc4 amd64 7.1.0-9 [51.0 kB]
Get:29 http://127.0.0.1:9999/debian unstable/main amd64 libobjc-6-dev amd64 6.4.0-1 [197 kB]
Get:30 http://127.0.0.1:9999/debian unstable/main amd64 libclang-common-3.9-dev amd64 1:3.9.1-10 [2573 kB]
Get:31 http://127.0.0.1:9999/debian unstable/main amd64 clang-3.9 amd64 1:3.9.1-10 [37.4 MB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 83.9 MB in 0s (96.2 MB/s)
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 9635 files and directories currently installed.)
Preparing to unpack .../libquadmath0_7.1.0-9_amd64.deb ...
Unpacking libquadmath0:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../libitm1_7.1.0-9_amd64.deb ...
Unpacking libitm1:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../gcc-7-base_7.1.0-9_amd64.deb ...
Unpacking gcc-7-base:amd64 (7.1.0-9) over (7.1.0-8) ...
Setting up gcc-7-base:amd64 (7.1.0-9) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 9635 files and directories currently installed.)
Preparing to unpack .../libstdc++6_7.1.0-9_amd64.deb ...
Unpacking libstdc++6:amd64 (7.1.0-9) over (7.1.0-8) ...
Setting up libstdc++6:amd64 (7.1.0-9) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 9635 files and directories currently installed.)
Preparing to unpack .../0-libmpx2_7.1.0-9_amd64.deb ...
Unpacking libmpx2:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../1-liblsan0_7.1.0-9_amd64.deb ...
Unpacking liblsan0:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../2-libtsan0_7.1.0-9_amd64.deb ...
Unpacking libtsan0:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../3-libubsan0_7.1.0-9_amd64.deb ...
Unpacking libubsan0:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../4-libcilkrts5_7.1.0-9_amd64.deb ...
Unpacking libcilkrts5:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../5-libcc1-0_7.1.0-9_amd64.deb ...
Unpacking libcc1-0:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../6-libatomic1_7.1.0-9_amd64.deb ...
Unpacking libatomic1:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../7-libgomp1_7.1.0-9_amd64.deb ...
Unpacking libgomp1:amd64 (7.1.0-9) over (7.1.0-8) ...
Preparing to unpack .../8-libgcc1_1%3a7.1.0-9_amd64.deb ...
Unpacking libgcc1:amd64 (1:7.1.0-9) over (1:7.1.0-8) ...
Setting up libgcc1:amd64 (1:7.1.0-9) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 9635 files and directories currently installed.)
Preparing to unpack .../00-libasan3_6.4.0-1_amd64.deb ...
Unpacking libasan3:amd64 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../01-g++-6_6.4.0-1_amd64.deb ...
Unpacking g++-6 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../02-libstdc++-6-dev_6.4.0-1_amd64.deb ...
Unpacking libstdc++-6-dev:amd64 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../03-gcc-6_6.4.0-1_amd64.deb ...
Unpacking gcc-6 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../04-libgcc-6-dev_6.4.0-1_amd64.deb ...
Unpacking libgcc-6-dev:amd64 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../05-cpp-6_6.4.0-1_amd64.deb ...
Unpacking cpp-6 (6.4.0-1) over (6.3.0-21) ...
Preparing to unpack .../06-gcc-6-base_6.4.0-1_amd64.deb ...
Unpacking gcc-6-base:amd64 (6.4.0-1) over (6.3.0-21) ...
Selecting previously unselected package libbsd0:amd64.
Preparing to unpack .../07-libbsd0_0.8.5-1_amd64.deb ...
Unpacking libbsd0:amd64 (0.8.5-1) ...
Selecting previously unselected package libncurses5:amd64.
Preparing to unpack .../08-libncurses5_6.0+20161126-1_amd64.deb ...
Unpacking libncurses5:amd64 (6.0+20161126-1) ...
Selecting previously unselected package libedit2:amd64.
Preparing to unpack .../09-libedit2_3.1-20170329-1_amd64.deb ...
Unpacking libedit2:amd64 (3.1-20170329-1) ...
Selecting previously unselected package libffi6:amd64.
Preparing to unpack .../10-libffi6_3.2.1-6_amd64.deb ...
Unpacking libffi6:amd64 (3.2.1-6) ...
Selecting previously unselected package libllvm3.9:amd64.
Preparing to unpack .../11-libllvm3.9_1%3a3.9.1-10_amd64.deb ...
Unpacking libllvm3.9:amd64 (1:3.9.1-10) ...
Selecting previously unselected package libclang1-3.9:amd64.
Preparing to unpack .../12-libclang1-3.9_1%3a3.9.1-10_amd64.deb ...
Unpacking libclang1-3.9:amd64 (1:3.9.1-10) ...
Selecting previously unselected package libjsoncpp1:amd64.
Preparing to unpack .../13-libjsoncpp1_1.7.4-3_amd64.deb ...
Unpacking libjsoncpp1:amd64 (1.7.4-3) ...
Selecting previously unselected package libobjc4:amd64.
Preparing to unpack .../14-libobjc4_7.1.0-9_amd64.deb ...
Unpacking libobjc4:amd64 (7.1.0-9) ...
Selecting previously unselected package libobjc-6-dev:amd64.
Preparing to unpack .../15-libobjc-6-dev_6.4.0-1_amd64.deb ...
Unpacking libobjc-6-dev:amd64 (6.4.0-1) ...
Selecting previously unselected package libclang-common-3.9-dev.
Preparing to unpack .../16-libclang-common-3.9-dev_1%3a3.9.1-10_amd64.deb ...
Unpacking libclang-common-3.9-dev (1:3.9.1-10) ...
Selecting previously unselected package clang-3.9.
Preparing to unpack .../17-clang-3.9_1%3a3.9.1-10_amd64.deb ...
Unpacking clang-3.9 (1:3.9.1-10) ...
Setting up libquadmath0:amd64 (7.1.0-9) ...
Setting up libncurses5:amd64 (6.0+20161126-1) ...
Setting up libgomp1:amd64 (7.1.0-9) ...
Setting up libatomic1:amd64 (7.1.0-9) ...
Setting up libcc1-0:amd64 (7.1.0-9) ...
Setting up libobjc4:amd64 (7.1.0-9) ...
Setting up libcilkrts5:amd64 (7.1.0-9) ...
Setting up libubsan0:amd64 (7.1.0-9) ...
Setting up libtsan0:amd64 (7.1.0-9) ...
Setting up gcc-6-base:amd64 (6.4.0-1) ...
Setting up libbsd0:amd64 (0.8.5-1) ...
Setting up liblsan0:amd64 (7.1.0-9) ...
Setting up libmpx2:amd64 (7.1.0-9) ...
Processing triggers for libc-bin (2.24-12) ...
Setting up libffi6:amd64 (3.2.1-6) ...
Setting up cpp-6 (6.4.0-1) ...
Setting up libitm1:amd64 (7.1.0-9) ...
Setting up libjsoncpp1:amd64 (1.7.4-3) ...
Setting up libedit2:amd64 (3.1-20170329-1) ...
Setting up libasan3:amd64 (6.4.0-1) ...
Setting up libgcc-6-dev:amd64 (6.4.0-1) ...
Setting up libstdc++-6-dev:amd64 (6.4.0-1) ...
Setting up libllvm3.9:amd64 (1:3.9.1-10) ...
Setting up libclang-common-3.9-dev (1:3.9.1-10) ...
Setting up gcc-6 (6.4.0-1) ...
Setting up g++-6 (6.4.0-1) ...
Setting up libobjc-6-dev:amd64 (6.4.0-1) ...
Setting up libclang1-3.9:amd64 (1:3.9.1-10) ...
Setting up clang-3.9 (1:3.9.1-10) ...
Processing triggers for libc-bin (2.24-12) ...
W: --force-yes is deprecated, use one of the options starting with --allow instead.
+ echo 'Replace gcc, g++ & cpp by clang'
Replace gcc, g++ & cpp by clang
+ VERSIONS='4.6 4.7 4.8 4.9 5 6 7'
+ cd /usr/bin
+ for VERSION in $VERSIONS
+ rm -f g++-4.6 gcc-4.6 cpp-4.6 gcc
+ ln -s clang++-3.9 g++-4.6
+ ln -s clang-3.9 gcc-4.6
+ ln -s clang-3.9 cpp-4.6
+ ln -s clang-3.9 gcc
+ echo 'gcc-4.6 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: gcc-4.6
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ echo 'g++-4.6 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: g++-4.6
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ for VERSION in $VERSIONS
+ rm -f g++-4.7 gcc-4.7 cpp-4.7 gcc
+ ln -s clang++-3.9 g++-4.7
+ ln -s clang-3.9 gcc-4.7
+ ln -s clang-3.9 cpp-4.7
+ ln -s clang-3.9 gcc
+ echo 'gcc-4.7 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: gcc-4.7
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ echo 'g++-4.7 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: g++-4.7
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ for VERSION in $VERSIONS
+ rm -f g++-4.8 gcc-4.8 cpp-4.8 gcc
+ ln -s clang++-3.9 g++-4.8
+ ln -s clang-3.9 gcc-4.8
+ ln -s clang-3.9 cpp-4.8
+ ln -s clang-3.9 gcc
+ echo 'gcc-4.8 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: gcc-4.8
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ echo 'g++-4.8 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: g++-4.8
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ for VERSION in $VERSIONS
+ rm -f g++-4.9 gcc-4.9 cpp-4.9 gcc
+ ln -s clang++-3.9 g++-4.9
+ ln -s clang-3.9 gcc-4.9
+ ln -s clang-3.9 cpp-4.9
+ ln -s clang-3.9 gcc
+ echo 'gcc-4.9 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: gcc-4.9
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ echo 'g++-4.9 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: g++-4.9
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ for VERSION in $VERSIONS
+ rm -f g++-5 gcc-5 cpp-5 gcc
+ ln -s clang++-3.9 g++-5
+ ln -s clang-3.9 gcc-5
+ ln -s clang-3.9 cpp-5
+ ln -s clang-3.9 gcc
+ echo 'gcc-5 hold'
+ dpkg --set-selections
+ echo 'g++-5 hold'
+ dpkg --set-selections
+ for VERSION in $VERSIONS
+ rm -f g++-6 gcc-6 cpp-6 gcc
+ ln -s clang++-3.9 g++-6
+ ln -s clang-3.9 gcc-6
+ ln -s clang-3.9 cpp-6
+ ln -s clang-3.9 gcc
+ echo 'gcc-6 hold'
+ dpkg --set-selections
+ echo 'g++-6 hold'
+ dpkg --set-selections
+ for VERSION in $VERSIONS
+ rm -f g++-7 gcc-7 cpp-7 gcc
+ ln -s clang++-3.9 g++-7
+ ln -s clang-3.9 gcc-7
+ ln -s clang-3.9 cpp-7
+ ln -s clang-3.9 gcc
+ echo 'gcc-7 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: gcc-7
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ echo 'g++-7 hold'
+ dpkg --set-selections
dpkg: warning: package not in status nor available database at line 1: g++-7
dpkg: warning: found unknown packages; this might mean the available database
is outdated, and needs to be updated through a frontend method;
please see the FAQ <https://wiki.debian.org/Teams/Dpkg/FAQ>
+ cd -
/build/trinityrnaseq-ZHDNor
+ echo 'Check if gcc, g++ & cpp are actually clang'
Check if gcc, g++ & cpp are actually clang
+ gcc --version
+ grep clang
+ cpp --version
+ grep clang
+ g++ --version
+ grep clang

I: Finished running '/tmp/clang'.

Finished processing commands.
--------------------------------------------------------------------------------

+------------------------------------------------------------------------------+
| Update chroot                                                                |
+------------------------------------------------------------------------------+

Hit:1 http://127.0.0.1:9999/debian unstable InRelease
Reading package lists...
Reading package lists...
Building dependency tree...
Reading state information...
Calculating upgrade...
The following NEW packages will be installed:
  libgnutls30 libhogweed4 libidn2-0 libnettle6 libp11-kit0 libtasn1-6
  libunistring2
The following packages will be upgraded:
  apt cpp debconf g++ gcc libapt-pkg5.0 libdebconfclient0 libperl5.24
  libsystemd0 libudev1 perl perl-base perl-modules-5.24
13 upgraded, 7 newly installed, 0 to remove and 0 not upgraded.
Need to get 12.5 MB of archives.
After this operation, 6330 kB of additional disk space will be used.
Get:1 http://127.0.0.1:9999/debian unstable/main amd64 libperl5.24 amd64 5.24.1-6 [3525 kB]
Get:2 http://127.0.0.1:9999/debian unstable/main amd64 perl amd64 5.24.1-6 [218 kB]
Get:3 http://127.0.0.1:9999/debian unstable/main amd64 perl-base amd64 5.24.1-6 [1344 kB]
Get:4 http://127.0.0.1:9999/debian unstable/main amd64 perl-modules-5.24 all 5.24.1-6 [2723 kB]
Get:5 http://127.0.0.1:9999/debian unstable/main amd64 libapt-pkg5.0 amd64 1.5~beta1 [922 kB]
Get:6 http://127.0.0.1:9999/debian unstable/main amd64 libnettle6 amd64 3.3-1+b1 [191 kB]
Get:7 http://127.0.0.1:9999/debian unstable/main amd64 libhogweed4 amd64 3.3-1+b1 [136 kB]
Get:8 http://127.0.0.1:9999/debian unstable/main amd64 libunistring2 amd64 0.9.7-2 [377 kB]
Get:9 http://127.0.0.1:9999/debian unstable/main amd64 libidn2-0 amd64 0.16-1+b1 [56.6 kB]
Get:10 http://127.0.0.1:9999/debian unstable/main amd64 libp11-kit0 amd64 0.23.7-2 [193 kB]
Get:11 http://127.0.0.1:9999/debian unstable/main amd64 libtasn1-6 amd64 4.12-2 [51.0 kB]
Get:12 http://127.0.0.1:9999/debian unstable/main amd64 libgnutls30 amd64 3.5.13-2 [914 kB]
Get:13 http://127.0.0.1:9999/debian unstable/main amd64 apt amd64 1.5~beta1 [1237 kB]
Get:14 http://127.0.0.1:9999/debian unstable/main amd64 debconf all 1.5.62 [160 kB]
Get:15 http://127.0.0.1:9999/debian unstable/main amd64 libsystemd0 amd64 233-10 [281 kB]
Get:16 http://127.0.0.1:9999/debian unstable/main amd64 libudev1 amd64 233-10 [126 kB]
Get:17 http://127.0.0.1:9999/debian unstable/main amd64 libdebconfclient0 amd64 0.229 [47.9 kB]
Get:18 http://127.0.0.1:9999/debian unstable/main amd64 cpp amd64 4:6.3.0-4d1 [18.8 kB]
Get:19 http://127.0.0.1:9999/debian unstable/main amd64 gcc amd64 4:6.3.0-4d1 [5252 B]
Get:20 http://127.0.0.1:9999/debian unstable/main amd64 g++ amd64 4:6.3.0-4d1 [1548 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 12.5 MB in 0s (86.5 MB/s)
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10107 files and directories currently installed.)
Preparing to unpack .../libperl5.24_5.24.1-6_amd64.deb ...
Unpacking libperl5.24:amd64 (5.24.1-6) over (5.24.1-4) ...
Preparing to unpack .../perl_5.24.1-6_amd64.deb ...
Unpacking perl (5.24.1-6) over (5.24.1-4) ...
Preparing to unpack .../perl-base_5.24.1-6_amd64.deb ...
Unpacking perl-base (5.24.1-6) over (5.24.1-4) ...
Setting up perl-base (5.24.1-6) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10107 files and directories currently installed.)
Preparing to unpack .../perl-modules-5.24_5.24.1-6_all.deb ...
Unpacking perl-modules-5.24 (5.24.1-6) over (5.24.1-4) ...
Preparing to unpack .../libapt-pkg5.0_1.5~beta1_amd64.deb ...
Unpacking libapt-pkg5.0:amd64 (1.5~beta1) over (1.4.6) ...
Setting up libapt-pkg5.0:amd64 (1.5~beta1) ...
Selecting previously unselected package libnettle6:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10107 files and directories currently installed.)
Preparing to unpack .../libnettle6_3.3-1+b1_amd64.deb ...
Unpacking libnettle6:amd64 (3.3-1+b1) ...
Setting up libnettle6:amd64 (3.3-1+b1) ...
Selecting previously unselected package libhogweed4:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10114 files and directories currently installed.)
Preparing to unpack .../libhogweed4_3.3-1+b1_amd64.deb ...
Unpacking libhogweed4:amd64 (3.3-1+b1) ...
Setting up libhogweed4:amd64 (3.3-1+b1) ...
Selecting previously unselected package libunistring2:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10117 files and directories currently installed.)
Preparing to unpack .../libunistring2_0.9.7-2_amd64.deb ...
Unpacking libunistring2:amd64 (0.9.7-2) ...
Setting up libunistring2:amd64 (0.9.7-2) ...
Selecting previously unselected package libidn2-0:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10123 files and directories currently installed.)
Preparing to unpack .../libidn2-0_0.16-1+b1_amd64.deb ...
Unpacking libidn2-0:amd64 (0.16-1+b1) ...
Setting up libidn2-0:amd64 (0.16-1+b1) ...
Selecting previously unselected package libp11-kit0:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10133 files and directories currently installed.)
Preparing to unpack .../libp11-kit0_0.23.7-2_amd64.deb ...
Unpacking libp11-kit0:amd64 (0.23.7-2) ...
Setting up libp11-kit0:amd64 (0.23.7-2) ...
Selecting previously unselected package libtasn1-6:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10141 files and directories currently installed.)
Preparing to unpack .../libtasn1-6_4.12-2_amd64.deb ...
Unpacking libtasn1-6:amd64 (4.12-2) ...
Setting up libtasn1-6:amd64 (4.12-2) ...
Selecting previously unselected package libgnutls30:amd64.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10150 files and directories currently installed.)
Preparing to unpack .../libgnutls30_3.5.13-2_amd64.deb ...
Unpacking libgnutls30:amd64 (3.5.13-2) ...
Setting up libgnutls30:amd64 (3.5.13-2) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10177 files and directories currently installed.)
Preparing to unpack .../apt_1.5~beta1_amd64.deb ...
Unpacking apt (1.5~beta1) over (1.4.6) ...
Setting up apt (1.5~beta1) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10176 files and directories currently installed.)
Preparing to unpack .../debconf_1.5.62_all.deb ...
Unpacking debconf (1.5.62) over (1.5.61) ...
Setting up debconf (1.5.62) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10176 files and directories currently installed.)
Preparing to unpack .../libsystemd0_233-10_amd64.deb ...
Unpacking libsystemd0:amd64 (233-10) over (233-9) ...
Setting up libsystemd0:amd64 (233-10) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10176 files and directories currently installed.)
Preparing to unpack .../libudev1_233-10_amd64.deb ...
Unpacking libudev1:amd64 (233-10) over (233-9) ...
Setting up libudev1:amd64 (233-10) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10176 files and directories currently installed.)
Preparing to unpack .../libdebconfclient0_0.229_amd64.deb ...
Unpacking libdebconfclient0:amd64 (0.229) over (0.228) ...
Setting up libdebconfclient0:amd64 (0.229) ...
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 10176 files and directories currently installed.)
Preparing to unpack .../cpp_4%3a6.3.0-4d1_amd64.deb ...
Unpacking cpp (4:6.3.0-4d1) over (4:6.3.0-4) ...
Preparing to unpack .../gcc_4%3a6.3.0-4d1_amd64.deb ...
Removing old gcc doc directory.
Unpacking gcc (4:6.3.0-4d1) over (4:6.3.0-4) ...
Preparing to unpack .../g++_4%3a6.3.0-4d1_amd64.deb ...
Unpacking g++ (4:6.3.0-4d1) over (4:6.3.0-4) ...
Setting up cpp (4:6.3.0-4d1) ...
Setting up perl-modules-5.24 (5.24.1-6) ...
Setting up libperl5.24:amd64 (5.24.1-6) ...
Setting up gcc (4:6.3.0-4d1) ...
Setting up perl (5.24.1-6) ...
Processing triggers for libc-bin (2.24-12) ...
Setting up g++ (4:6.3.0-4d1) ...

+------------------------------------------------------------------------------+
| Fetch source files                                                           |
+------------------------------------------------------------------------------+


Check APT
---------

Checking available source versions...

Download source files with APT
------------------------------

Reading package lists...
NOTICE: 'trinityrnaseq' packaging is maintained in the 'Git' version control system at:
https://anonscm.debian.org/git/debian-med/trinityrnaseq.git
Please use:
git clone https://anonscm.debian.org/git/debian-med/trinityrnaseq.git
to retrieve the latest (possibly unreleased) updates to the package.
Need to get 155 MB of source archives.
Get:1 http://127.0.0.1:9999/debian unstable/main trinityrnaseq 2.2.0+dfsg-2 (dsc) [2274 B]
Get:2 http://127.0.0.1:9999/debian unstable/main trinityrnaseq 2.2.0+dfsg-2 (tar) [155 MB]
Get:3 http://127.0.0.1:9999/debian unstable/main trinityrnaseq 2.2.0+dfsg-2 (diff) [17.1 kB]
Fetched 155 MB in 1s (90.3 MB/s)
Download complete and in download only mode
I: NOTICE: Log filtering will replace 'build/trinityrnaseq-ZHDNor/trinityrnaseq-2.2.0+dfsg' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/trinityrnaseq-ZHDNor' with '<<BUILDDIR>>'

+------------------------------------------------------------------------------+
| Install build-essential                                                      |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: build-essential, fakeroot
Filtered Build-Depends: build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-core-dummy' in '/<<BUILDDIR>>/resolver-AEzNVv/apt_archive/sbuild-build-depends-core-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning:   sbuild-build-depends-core-dummy
dpkg-scanpackages: info: Wrote 1 entries to output Packages file.
Ign:1 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Release [957 B]
Ign:3 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Release.gpg
Get:4 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Sources [349 B]
Get:5 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Packages [433 B]
Fetched 1739 B in 0s (0 B/s)
Reading package lists...
Reading package lists...

Install core build dependencies (apt-based resolver)
----------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following NEW packages will be installed:
  sbuild-build-depends-core-dummy
0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded.
Need to get 778 B of archives.
After this operation, 0 B of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ sbuild-build-depends-core-dummy 0.invalid.0 [778 B]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 778 B in 0s (0 B/s)
Selecting previously unselected package sbuild-build-depends-core-dummy.
(Reading database ... 10178 files and directories currently installed.)
Preparing to unpack .../sbuild-build-depends-core-dummy_0.invalid.0_amd64.deb ...
Unpacking sbuild-build-depends-core-dummy (0.invalid.0) ...
Setting up sbuild-build-depends-core-dummy (0.invalid.0) ...

+------------------------------------------------------------------------------+
| Check architectures                                                          |
+------------------------------------------------------------------------------+

Arch check ok (amd64 included in any all)

+------------------------------------------------------------------------------+
| Install package build dependencies                                           |
+------------------------------------------------------------------------------+


Setup apt archive
-----------------

Merged Build-Depends: debhelper (>= 9), autotools-dev, dh-autoreconf, automake1.11, jellyfish (>= 2.1.4), libjung-free-java, javahelper, libgetopt-java, default-jdk, parafly, libjs-jquery, jaligner, libhts-dev
Filtered Build-Depends: debhelper (>= 9), autotools-dev, dh-autoreconf, automake1.11, jellyfish (>= 2.1.4), libjung-free-java, javahelper, libgetopt-java, default-jdk, parafly, libjs-jquery, jaligner, libhts-dev
dpkg-deb: building package 'sbuild-build-depends-trinityrnaseq-dummy' in '/<<BUILDDIR>>/resolver-AEzNVv/apt_archive/sbuild-build-depends-trinityrnaseq-dummy.deb'.
dpkg-scanpackages: warning: Packages in archive but missing from override file:
dpkg-scanpackages: warning:   sbuild-build-depends-core-dummy sbuild-build-depends-trinityrnaseq-dummy
dpkg-scanpackages: info: Wrote 2 entries to output Packages file.
Ign:1 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ InRelease
Get:2 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Release [963 B]
Ign:3 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Release.gpg
Get:4 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Sources [590 B]
Get:5 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ Packages [668 B]
Fetched 2221 B in 0s (0 B/s)
Reading package lists...
Reading package lists...

Install trinityrnaseq build dependencies (apt-based resolver)
-------------------------------------------------------------

Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
  adwaita-icon-theme autoconf automake automake1.11 autopoint autotools-dev
  bsdmainutils ca-certificates ca-certificates-java dconf-gsettings-backend
  dconf-service dctrl-tools debhelper default-jdk default-jdk-headless
  default-jre default-jre-headless devscripts dh-autoreconf dh-python
  dh-strip-nondeterminism file fontconfig fontconfig-config fonts-dejavu-core
  gettext gettext-base glib-networking glib-networking-common
  glib-networking-services gnome-icon-theme groff-base
  gsettings-desktop-schemas gtk-update-icon-cache hicolor-icon-theme
  intltool-debian jaligner java-common javahelper jellyfish
  libarchive-zip-perl libasound2 libasound2-data libasyncns0
  libatk-bridge2.0-0 libatk-wrapper-java libatk-wrapper-java-jni libatk1.0-0
  libatk1.0-data libatspi2.0-0 libavahi-client3 libavahi-common-data
  libavahi-common3 libcairo-gobject2 libcairo2 libcap2 libcolord2
  libcolt-free-java libcommons-collections4-java libconcurrent-java libcroco3
  libcups2 libcurl3-gnutls libdatrie1 libdbus-1-3 libdconf1 libdrm2
  libegl1-mesa libepoxy0 libexpat1 libfile-homedir-perl
  libfile-stripnondeterminism-perl libfile-which-perl libflac8 libfontconfig1
  libfontenc1 libfreetype6 libgbm1 libgdk-pixbuf2.0-0 libgdk-pixbuf2.0-common
  libgetopt-java libgif7 libgl1-mesa-glx libglapi-mesa libglib2.0-0
  libgraphite2-3 libgssapi-krb5-2 libgtk-3-0 libgtk-3-common libgtk2.0-0
  libgtk2.0-common libharfbuzz0b libhts-dev libhts2 libice6 libicu57 libjbig0
  libjellyfish-2.0-2 libjpeg62-turbo libjs-jquery libjson-glib-1.0-0
  libjson-glib-1.0-common libjung-free-java libk5crypto3 libkeyutils1
  libkrb5-3 libkrb5support0 liblcms2-2 libldap-2.4-2 libldap-common
  libmagic-mgc libmagic1 libmpdec2 libnghttp2-14 libnspr4 libnss3 libogg0
  libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libpcsclite1
  libpipeline1 libpixman-1-0 libpng16-16 libproxy1v5 libpsl5 libpulse0
  libpython3-stdlib libpython3.5-minimal libpython3.5-stdlib libreadline7
  librest-0.7-0 librsvg2-2 librsvg2-common librtmp1 libsasl2-2
  libsasl2-modules-db libsigsegv2 libsm6 libsndfile1 libsoup-gnome2.4-1
  libsoup2.4-1 libsqlite3-0 libssh2-1 libssl1.1 libthai-data libthai0 libtiff5
  libtimedate-perl libtool libvecmath-java libvorbis0a libvorbisenc2
  libwayland-client0 libwayland-cursor0 libwayland-egl1-mesa
  libwayland-server0 libwrap0 libx11-6 libx11-data libx11-xcb1 libxau6 libxaw7
  libxcb-dri2-0 libxcb-dri3-0 libxcb-glx0 libxcb-present0 libxcb-render0
  libxcb-shape0 libxcb-shm0 libxcb-sync1 libxcb-xfixes0 libxcb1 libxcomposite1
  libxcursor1 libxdamage1 libxdmcp6 libxext6 libxfixes3 libxft2 libxi6
  libxinerama1 libxkbcommon0 libxml2 libxmu6 libxmuu1 libxpm4 libxrandr2
  libxrender1 libxshmfence1 libxt6 libxtst6 libxv1 libxxf86dga1 libxxf86vm1
  lsb-base m4 man-db mime-support openjdk-8-jdk openjdk-8-jdk-headless
  openjdk-8-jre openjdk-8-jre-headless openssl parafly po-debconf python3
  python3-minimal python3.5 python3.5-minimal readline-common shared-mime-info
  ucf x11-common x11-utils xkb-data
Suggested packages:
  autoconf-archive gnu-standards autoconf-doc wamerican | wordlist whois
  vacation debtags dh-make adequate autopkgtest bls-standalone bsd-mailx
  | mailx check-all-the-things cvs-buildpackage devscripts-el diffoscope
  disorderfs dose-extra duck faketime gnuplot how-can-i-help
  libauthen-sasl-perl libfile-desktopentry-perl libnet-smtps-perl
  libterm-size-perl libyaml-syck-perl mozilla-devscripts mutt piuparts ratt
  reprotest ssh-client svn-buildpackage w3m gettext-doc libasprintf-dev
  libgettextpo-dev groff cvs gawk tofrodos libasound2-plugins alsa-utils
  colord libcommons-collections4-java-doc cups-common libgetopt-java-doc
  krb5-doc krb5-user gvfs liblcms2-utils pcscd pulseaudio librsvg2-bin
  libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc less www-browser
  openjdk-8-demo openjdk-8-source visualvm icedtea-8-plugin libnss-mdns
  fonts-dejavu-extra fonts-ipafont-gothic fonts-ipafont-mincho
  fonts-wqy-microhei fonts-wqy-zenhei fonts-indic libmail-box-perl python3-doc
  python3-tk python3-venv python3.5-venv python3.5-doc binfmt-support
  readline-doc mesa-utils
Recommended packages:
  default-java-plugin at dput | dupload gnupg | gnupg2 libdistro-info-perl
  libencode-locale-perl libgit-wrapper-perl liblist-compare-perl liburi-perl
  libwww-perl licensecheck lintian patchutils python3-debian python3-magic
  strace unzip wdiff wget | curl debian-keyring equivs
  liblwp-protocol-https-perl libsoap-lite-perl curl | wget | lynx-cur
  at-spi2-core dbus libarchive-cpio-perl libgl1-mesa-dri libglib2.0-data
  xdg-user-dirs libgtk-3-bin libgail-common libgtk2.0-bin javascript-common
  krb5-locales publicsuffix libsasl2-modules libltdl-dev tcpd xml-core
  libxt-dev fonts-dejavu-extra libmail-sendmail-perl
The following NEW packages will be installed:
  adwaita-icon-theme autoconf automake automake1.11 autopoint autotools-dev
  bsdmainutils ca-certificates ca-certificates-java dconf-gsettings-backend
  dconf-service dctrl-tools debhelper default-jdk default-jdk-headless
  default-jre default-jre-headless devscripts dh-autoreconf dh-python
  dh-strip-nondeterminism file fontconfig fontconfig-config fonts-dejavu-core
  gettext gettext-base glib-networking glib-networking-common
  glib-networking-services gnome-icon-theme groff-base
  gsettings-desktop-schemas gtk-update-icon-cache hicolor-icon-theme
  intltool-debian jaligner java-common javahelper jellyfish
  libarchive-zip-perl libasound2 libasound2-data libasyncns0
  libatk-bridge2.0-0 libatk-wrapper-java libatk-wrapper-java-jni libatk1.0-0
  libatk1.0-data libatspi2.0-0 libavahi-client3 libavahi-common-data
  libavahi-common3 libcairo-gobject2 libcairo2 libcap2 libcolord2
  libcolt-free-java libcommons-collections4-java libconcurrent-java libcroco3
  libcups2 libcurl3-gnutls libdatrie1 libdbus-1-3 libdconf1 libdrm2
  libegl1-mesa libepoxy0 libexpat1 libfile-homedir-perl
  libfile-stripnondeterminism-perl libfile-which-perl libflac8 libfontconfig1
  libfontenc1 libfreetype6 libgbm1 libgdk-pixbuf2.0-0 libgdk-pixbuf2.0-common
  libgetopt-java libgif7 libgl1-mesa-glx libglapi-mesa libglib2.0-0
  libgraphite2-3 libgssapi-krb5-2 libgtk-3-0 libgtk-3-common libgtk2.0-0
  libgtk2.0-common libharfbuzz0b libhts-dev libhts2 libice6 libicu57 libjbig0
  libjellyfish-2.0-2 libjpeg62-turbo libjs-jquery libjson-glib-1.0-0
  libjson-glib-1.0-common libjung-free-java libk5crypto3 libkeyutils1
  libkrb5-3 libkrb5support0 liblcms2-2 libldap-2.4-2 libldap-common
  libmagic-mgc libmagic1 libmpdec2 libnghttp2-14 libnspr4 libnss3 libogg0
  libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libpcsclite1
  libpipeline1 libpixman-1-0 libpng16-16 libproxy1v5 libpsl5 libpulse0
  libpython3-stdlib libpython3.5-minimal libpython3.5-stdlib libreadline7
  librest-0.7-0 librsvg2-2 librsvg2-common librtmp1 libsasl2-2
  libsasl2-modules-db libsigsegv2 libsm6 libsndfile1 libsoup-gnome2.4-1
  libsoup2.4-1 libsqlite3-0 libssh2-1 libssl1.1 libthai-data libthai0 libtiff5
  libtimedate-perl libtool libvecmath-java libvorbis0a libvorbisenc2
  libwayland-client0 libwayland-cursor0 libwayland-egl1-mesa
  libwayland-server0 libwrap0 libx11-6 libx11-data libx11-xcb1 libxau6 libxaw7
  libxcb-dri2-0 libxcb-dri3-0 libxcb-glx0 libxcb-present0 libxcb-render0
  libxcb-shape0 libxcb-shm0 libxcb-sync1 libxcb-xfixes0 libxcb1 libxcomposite1
  libxcursor1 libxdamage1 libxdmcp6 libxext6 libxfixes3 libxft2 libxi6
  libxinerama1 libxkbcommon0 libxml2 libxmu6 libxmuu1 libxpm4 libxrandr2
  libxrender1 libxshmfence1 libxt6 libxtst6 libxv1 libxxf86dga1 libxxf86vm1
  lsb-base m4 man-db mime-support openjdk-8-jdk openjdk-8-jdk-headless
  openjdk-8-jre openjdk-8-jre-headless openssl parafly po-debconf python3
  python3-minimal python3.5 python3.5-minimal readline-common
  sbuild-build-depends-trinityrnaseq-dummy shared-mime-info ucf x11-common
  x11-utils xkb-data
0 upgraded, 217 newly installed, 0 to remove and 0 not upgraded.
Need to get 122 MB of archives.
After this operation, 423 MB of additional disk space will be used.
Get:1 copy:/<<BUILDDIR>>/resolver-AEzNVv/apt_archive ./ sbuild-build-depends-trinityrnaseq-dummy 0.invalid.0 [886 B]
Get:2 http://127.0.0.1:9999/debian unstable/main amd64 groff-base amd64 1.22.3-9 [1160 kB]
Get:3 http://127.0.0.1:9999/debian unstable/main amd64 bsdmainutils amd64 9.0.12+nmu1 [186 kB]
Get:4 http://127.0.0.1:9999/debian unstable/main amd64 libpipeline1 amd64 1.4.1-2 [27.6 kB]
Get:5 http://127.0.0.1:9999/debian unstable/main amd64 man-db amd64 2.7.6.1-2 [1044 kB]
Get:6 http://127.0.0.1:9999/debian unstable/main amd64 libexpat1 amd64 2.2.1-3 [85.6 kB]
Get:7 http://127.0.0.1:9999/debian unstable/main amd64 libpng16-16 amd64 1.6.29-3 [281 kB]
Get:8 http://127.0.0.1:9999/debian unstable/main amd64 libfreetype6 amd64 2.8-0.2 [449 kB]
Get:9 http://127.0.0.1:9999/debian unstable/main amd64 ucf all 3.0036 [70.2 kB]
Get:10 http://127.0.0.1:9999/debian unstable/main amd64 fonts-dejavu-core all 2.37-1 [1068 kB]
Get:11 http://127.0.0.1:9999/debian unstable/main amd64 fontconfig-config all 2.12.3-0.1 [303 kB]
Get:12 http://127.0.0.1:9999/debian unstable/main amd64 libfontconfig1 amd64 2.12.3-0.1 [366 kB]
Get:13 http://127.0.0.1:9999/debian unstable/main amd64 fontconfig amd64 2.12.3-0.1 [436 kB]
Get:14 http://127.0.0.1:9999/debian unstable/main amd64 libogg0 amd64 1.3.2-1 [19.9 kB]
Get:15 http://127.0.0.1:9999/debian unstable/main amd64 libxau6 amd64 1:1.0.8-1 [20.7 kB]
Get:16 http://127.0.0.1:9999/debian unstable/main amd64 libssl1.1 amd64 1.1.0f-3 [1342 kB]
Get:17 http://127.0.0.1:9999/debian unstable/main amd64 openssl amd64 1.1.0f-3 [725 kB]
Get:18 http://127.0.0.1:9999/debian unstable/main amd64 ca-certificates all 20161130+nmu1 [196 kB]
Get:19 http://127.0.0.1:9999/debian unstable/main amd64 java-common all 0.59 [13.6 kB]
Get:20 http://127.0.0.1:9999/debian unstable/main amd64 default-jre-headless amd64 2:1.8-59 [10.0 kB]
Get:21 http://127.0.0.1:9999/debian unstable/main amd64 libnspr4 amd64 2:4.15-1 [117 kB]
Get:22 http://127.0.0.1:9999/debian unstable/main amd64 libsqlite3-0 amd64 3.16.2-5 [572 kB]
Get:23 http://127.0.0.1:9999/debian unstable/main amd64 libnss3 amd64 2:3.31-1 [1160 kB]
Get:24 http://127.0.0.1:9999/debian unstable/main amd64 ca-certificates-java all 20170531+nmu1 [14.7 kB]
Get:25 http://127.0.0.1:9999/debian unstable/main amd64 libavahi-common-data amd64 0.6.32-2 [118 kB]
Get:26 http://127.0.0.1:9999/debian unstable/main amd64 libavahi-common3 amd64 0.6.32-2 [52.0 kB]
Get:27 http://127.0.0.1:9999/debian unstable/main amd64 libdbus-1-3 amd64 1.10.20-1 [193 kB]
Get:28 http://127.0.0.1:9999/debian unstable/main amd64 libavahi-client3 amd64 0.6.32-2 [55.3 kB]
Get:29 http://127.0.0.1:9999/debian unstable/main amd64 libkeyutils1 amd64 1.5.9-9 [12.4 kB]
Get:30 http://127.0.0.1:9999/debian unstable/main amd64 libkrb5support0 amd64 1.15-1 [61.7 kB]
Get:31 http://127.0.0.1:9999/debian unstable/main amd64 libk5crypto3 amd64 1.15-1 [119 kB]
Get:32 http://127.0.0.1:9999/debian unstable/main amd64 libkrb5-3 amd64 1.15-1 [311 kB]
Get:33 http://127.0.0.1:9999/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.15-1 [154 kB]
Get:34 http://127.0.0.1:9999/debian unstable/main amd64 libcups2 amd64 2.2.4-1 [313 kB]
Get:35 http://127.0.0.1:9999/debian unstable/main amd64 liblcms2-2 amd64 2.8-4 [143 kB]
Get:36 http://127.0.0.1:9999/debian unstable/main amd64 libjpeg62-turbo amd64 1:1.5.1-2 [134 kB]
Get:37 http://127.0.0.1:9999/debian unstable/main amd64 libpcsclite1 amd64 1.8.22-1 [57.2 kB]
Get:38 http://127.0.0.1:9999/debian unstable/main amd64 libxdmcp6 amd64 1:1.1.2-3 [26.3 kB]
Get:39 http://127.0.0.1:9999/debian unstable/main amd64 libxcb1 amd64 1.12-1 [133 kB]
Get:40 http://127.0.0.1:9999/debian unstable/main amd64 libx11-data all 2:1.6.4-3 [290 kB]
Get:41 http://127.0.0.1:9999/debian unstable/main amd64 libx11-6 amd64 2:1.6.4-3 [747 kB]
Get:42 http://127.0.0.1:9999/debian unstable/main amd64 libxext6 amd64 2:1.3.3-1+b2 [52.5 kB]
Get:43 http://127.0.0.1:9999/debian unstable/main amd64 libxi6 amd64 2:1.7.9-1 [82.6 kB]
Get:44 http://127.0.0.1:9999/debian unstable/main amd64 libxrender1 amd64 1:0.9.10-1 [33.0 kB]
Get:45 http://127.0.0.1:9999/debian unstable/main amd64 lsb-base all 9.20161125 [27.9 kB]
Get:46 http://127.0.0.1:9999/debian unstable/main amd64 x11-common all 1:7.7+19 [251 kB]
Get:47 http://127.0.0.1:9999/debian unstable/main amd64 libxtst6 amd64 2:1.2.3-1 [27.8 kB]
Get:48 http://127.0.0.1:9999/debian unstable/main amd64 openjdk-8-jre-headless amd64 8u131-b11-2 [27.7 MB]
Get:49 http://127.0.0.1:9999/debian unstable/main amd64 libpython3.5-minimal amd64 3.5.3-3 [577 kB]
Get:50 http://127.0.0.1:9999/debian unstable/main amd64 python3.5-minimal amd64 3.5.3-3 [1695 kB]
Get:51 http://127.0.0.1:9999/debian unstable/main amd64 python3-minimal amd64 3.5.3-3 [35.4 kB]
Get:52 http://127.0.0.1:9999/debian unstable/main amd64 mime-support all 3.60 [36.7 kB]
Get:53 http://127.0.0.1:9999/debian unstable/main amd64 libmpdec2 amd64 2.4.2-1 [85.2 kB]
Get:54 http://127.0.0.1:9999/debian unstable/main amd64 readline-common all 7.0-3 [70.4 kB]
Get:55 http://127.0.0.1:9999/debian unstable/main amd64 libreadline7 amd64 7.0-3 [151 kB]
Get:56 http://127.0.0.1:9999/debian unstable/main amd64 libpython3.5-stdlib amd64 3.5.3-3 [2170 kB]
Get:57 http://127.0.0.1:9999/debian unstable/main amd64 python3.5 amd64 3.5.3-3 [237 kB]
Get:58 http://127.0.0.1:9999/debian unstable/main amd64 libpython3-stdlib amd64 3.5.3-3 [18.8 kB]
Get:59 http://127.0.0.1:9999/debian unstable/main amd64 dh-python all 2.20170125 [86.8 kB]
Get:60 http://127.0.0.1:9999/debian unstable/main amd64 python3 amd64 3.5.3-3 [21.8 kB]
Get:61 http://127.0.0.1:9999/debian unstable/main amd64 libmagic-mgc amd64 1:5.30-1 [222 kB]
Get:62 http://127.0.0.1:9999/debian unstable/main amd64 libmagic1 amd64 1:5.30-1 [111 kB]
Get:63 http://127.0.0.1:9999/debian unstable/main amd64 file amd64 1:5.30-1 [63.9 kB]
Get:64 http://127.0.0.1:9999/debian unstable/main amd64 gettext-base amd64 0.19.8.1-2+b1 [122 kB]
Get:65 http://127.0.0.1:9999/debian unstable/main amd64 libcap2 amd64 1:2.25-1 [16.8 kB]
Get:66 http://127.0.0.1:9999/debian unstable/main amd64 libsasl2-modules-db amd64 2.1.27~101-g0780600+dfsg-3 [68.2 kB]
Get:67 http://127.0.0.1:9999/debian unstable/main amd64 libsasl2-2 amd64 2.1.27~101-g0780600+dfsg-3 [105 kB]
Get:68 http://127.0.0.1:9999/debian unstable/main amd64 libldap-common all 2.4.44+dfsg-7 [85.2 kB]
Get:69 http://127.0.0.1:9999/debian unstable/main amd64 libldap-2.4-2 amd64 2.4.44+dfsg-7 [219 kB]
Get:70 http://127.0.0.1:9999/debian unstable/main amd64 libwrap0 amd64 7.6.q-26 [58.2 kB]
Get:71 http://127.0.0.1:9999/debian unstable/main amd64 libicu57 amd64 57.1-6 [7701 kB]
Get:72 http://127.0.0.1:9999/debian unstable/main amd64 libxml2 amd64 2.9.4+dfsg1-3 [715 kB]
Get:73 http://127.0.0.1:9999/debian unstable/main amd64 hicolor-icon-theme all 0.15-1 [9550 B]
Get:74 http://127.0.0.1:9999/debian unstable/main amd64 libglib2.0-0 amd64 2.52.3-1 [2742 kB]
Get:75 http://127.0.0.1:9999/debian unstable/main amd64 libjbig0 amd64 2.1-3.1+b2 [31.0 kB]
Get:76 http://127.0.0.1:9999/debian unstable/main amd64 libtiff5 amd64 4.0.8-3 [237 kB]
Get:77 http://127.0.0.1:9999/debian unstable/main amd64 shared-mime-info amd64 1.8-1 [731 kB]
Get:78 http://127.0.0.1:9999/debian unstable/main amd64 libgdk-pixbuf2.0-common all 2.36.5-2 [310 kB]
Get:79 http://127.0.0.1:9999/debian unstable/main amd64 libgdk-pixbuf2.0-0 amd64 2.36.5-2 [169 kB]
Get:80 http://127.0.0.1:9999/debian unstable/main amd64 gtk-update-icon-cache amd64 3.22.16-1 [76.7 kB]
Get:81 http://127.0.0.1:9999/debian unstable/main amd64 libpixman-1-0 amd64 0.34.0-1 [530 kB]
Get:82 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-render0 amd64 1.12-1 [105 kB]
Get:83 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-shm0 amd64 1.12-1 [95.9 kB]
Get:84 http://127.0.0.1:9999/debian unstable/main amd64 libcairo2 amd64 1.14.10-1 [774 kB]
Get:85 http://127.0.0.1:9999/debian unstable/main amd64 libcroco3 amd64 0.6.12-1 [144 kB]
Get:86 http://127.0.0.1:9999/debian unstable/main amd64 libthai-data all 0.1.26-1 [166 kB]
Get:87 http://127.0.0.1:9999/debian unstable/main amd64 libdatrie1 amd64 0.2.10-4+b1 [36.4 kB]
Get:88 http://127.0.0.1:9999/debian unstable/main amd64 libthai0 amd64 0.1.26-1 [52.1 kB]
Get:89 http://127.0.0.1:9999/debian unstable/main amd64 libpango-1.0-0 amd64 1.40.6-1 [182 kB]
Get:90 http://127.0.0.1:9999/debian unstable/main amd64 libgraphite2-3 amd64 1.3.10-2 [84.3 kB]
Get:91 http://127.0.0.1:9999/debian unstable/main amd64 libharfbuzz0b amd64 1.4.2-1 [671 kB]
Get:92 http://127.0.0.1:9999/debian unstable/main amd64 libpangoft2-1.0-0 amd64 1.40.6-1 [67.0 kB]
Get:93 http://127.0.0.1:9999/debian unstable/main amd64 libpangocairo-1.0-0 amd64 1.40.6-1 [54.8 kB]
Get:94 http://127.0.0.1:9999/debian unstable/main amd64 librsvg2-2 amd64 2.40.16-1+b1 [281 kB]
Get:95 http://127.0.0.1:9999/debian unstable/main amd64 librsvg2-common amd64 2.40.16-1+b1 [194 kB]
Get:96 http://127.0.0.1:9999/debian unstable/main amd64 adwaita-icon-theme all 3.22.0-1 [11.5 MB]
Get:97 http://127.0.0.1:9999/debian unstable/main amd64 libsigsegv2 amd64 2.11-1 [29.9 kB]
Get:98 http://127.0.0.1:9999/debian unstable/main amd64 m4 amd64 1.4.18-1 [202 kB]
Get:99 http://127.0.0.1:9999/debian unstable/main amd64 autoconf all 2.69-10 [338 kB]
Get:100 http://127.0.0.1:9999/debian unstable/main amd64 autotools-dev all 20161112.1 [73.4 kB]
Get:101 http://127.0.0.1:9999/debian unstable/main amd64 automake all 1:1.15.1-2 [736 kB]
Get:102 http://127.0.0.1:9999/debian unstable/main amd64 automake1.11 all 1:1.11.6-4 [535 kB]
Get:103 http://127.0.0.1:9999/debian unstable/main amd64 autopoint all 0.19.8.1-2 [433 kB]
Get:104 http://127.0.0.1:9999/debian unstable/main amd64 libdconf1 amd64 0.26.0-2+b1 [37.6 kB]
Get:105 http://127.0.0.1:9999/debian unstable/main amd64 dconf-service amd64 0.26.0-2+b1 [34.7 kB]
Get:106 http://127.0.0.1:9999/debian unstable/main amd64 dconf-gsettings-backend amd64 0.26.0-2+b1 [26.4 kB]
Get:107 http://127.0.0.1:9999/debian unstable/main amd64 dctrl-tools amd64 2.24-2+b1 [104 kB]
Get:108 http://127.0.0.1:9999/debian unstable/main amd64 libtool all 2.4.6-2 [545 kB]
Get:109 http://127.0.0.1:9999/debian unstable/main amd64 dh-autoreconf all 14 [15.9 kB]
Get:110 http://127.0.0.1:9999/debian unstable/main amd64 libarchive-zip-perl all 1.59-1 [95.5 kB]
Get:111 http://127.0.0.1:9999/debian unstable/main amd64 libfile-stripnondeterminism-perl all 0.035-2 [17.0 kB]
Get:112 http://127.0.0.1:9999/debian unstable/main amd64 libtimedate-perl all 2.3000-2 [42.2 kB]
Get:113 http://127.0.0.1:9999/debian unstable/main amd64 dh-strip-nondeterminism all 0.035-2 [10.7 kB]
Get:114 http://127.0.0.1:9999/debian unstable/main amd64 gettext amd64 0.19.8.1-2+b1 [1301 kB]
Get:115 http://127.0.0.1:9999/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.4 [26.3 kB]
Get:116 http://127.0.0.1:9999/debian unstable/main amd64 po-debconf all 1.0.20 [247 kB]
Get:117 http://127.0.0.1:9999/debian unstable/main amd64 debhelper all 10.6.2 [968 kB]
Get:118 http://127.0.0.1:9999/debian unstable/main amd64 libgtk2.0-common all 2.24.31-2 [2693 kB]
Get:119 http://127.0.0.1:9999/debian unstable/main amd64 libatk1.0-data all 2.22.0-1 [172 kB]
Get:120 http://127.0.0.1:9999/debian unstable/main amd64 libatk1.0-0 amd64 2.22.0-1 [78.4 kB]
Get:121 http://127.0.0.1:9999/debian unstable/main amd64 libxcomposite1 amd64 1:0.4.4-2 [16.5 kB]
Get:122 http://127.0.0.1:9999/debian unstable/main amd64 libxfixes3 amd64 1:5.0.3-1 [21.9 kB]
Get:123 http://127.0.0.1:9999/debian unstable/main amd64 libxcursor1 amd64 1:1.1.14-1+b4 [35.0 kB]
Get:124 http://127.0.0.1:9999/debian unstable/main amd64 libxdamage1 amd64 1:1.1.4-2+b3 [14.5 kB]
Get:125 http://127.0.0.1:9999/debian unstable/main amd64 libxinerama1 amd64 2:1.1.3-1+b3 [16.7 kB]
Get:126 http://127.0.0.1:9999/debian unstable/main amd64 libxrandr2 amd64 2:1.5.1-1 [37.5 kB]
Get:127 http://127.0.0.1:9999/debian unstable/main amd64 gnome-icon-theme all 3.12.0-2 [9890 kB]
Get:128 http://127.0.0.1:9999/debian unstable/main amd64 libgtk2.0-0 amd64 2.24.31-2 [1800 kB]
Get:129 http://127.0.0.1:9999/debian unstable/main amd64 libdrm2 amd64 2.4.81-2 [38.4 kB]
Get:130 http://127.0.0.1:9999/debian unstable/main amd64 libglapi-mesa amd64 17.1.4-1 [59.7 kB]
Get:131 http://127.0.0.1:9999/debian unstable/main amd64 libx11-xcb1 amd64 2:1.6.4-3 [183 kB]
Get:132 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-dri2-0 amd64 1.12-1 [97.2 kB]
Get:133 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-dri3-0 amd64 1.12-1 [95.6 kB]
Get:134 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-glx0 amd64 1.12-1 [113 kB]
Get:135 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-present0 amd64 1.12-1 [95.8 kB]
Get:136 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-sync1 amd64 1.12-1 [99.2 kB]
Get:137 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-xfixes0 amd64 1.12-1 [99.6 kB]
Get:138 http://127.0.0.1:9999/debian unstable/main amd64 libxshmfence1 amd64 1.2-1+b2 [7922 B]
Get:139 http://127.0.0.1:9999/debian unstable/main amd64 libxxf86vm1 amd64 1:1.1.4-1+b2 [20.8 kB]
Get:140 http://127.0.0.1:9999/debian unstable/main amd64 libgl1-mesa-glx amd64 17.1.4-1 [167 kB]
Get:141 http://127.0.0.1:9999/debian unstable/main amd64 libatspi2.0-0 amd64 2.24.1-1 [62.4 kB]
Get:142 http://127.0.0.1:9999/debian unstable/main amd64 libatk-bridge2.0-0 amd64 2.24.1-1 [57.4 kB]
Get:143 http://127.0.0.1:9999/debian unstable/main amd64 libcairo-gobject2 amd64 1.14.10-1 [339 kB]
Get:144 http://127.0.0.1:9999/debian unstable/main amd64 libgtk-3-common all 3.22.16-1 [3404 kB]
Get:145 http://127.0.0.1:9999/debian unstable/main amd64 libcolord2 amd64 1.3.3-2 [252 kB]
Get:146 http://127.0.0.1:9999/debian unstable/main amd64 libepoxy0 amd64 1.3.1-3 [176 kB]
Get:147 http://127.0.0.1:9999/debian unstable/main amd64 libjson-glib-1.0-common all 1.2.8-1 [168 kB]
Get:148 http://127.0.0.1:9999/debian unstable/main amd64 libjson-glib-1.0-0 amd64 1.2.8-1 [180 kB]
Get:149 http://127.0.0.1:9999/debian unstable/main amd64 libproxy1v5 amd64 0.4.14-3 [57.5 kB]
Get:150 http://127.0.0.1:9999/debian unstable/main amd64 glib-networking-common all 2.50.0-1 [49.1 kB]
Get:151 http://127.0.0.1:9999/debian unstable/main amd64 glib-networking-services amd64 2.50.0-1+b1 [12.3 kB]
Get:152 http://127.0.0.1:9999/debian unstable/main amd64 gsettings-desktop-schemas all 3.22.0-1 [473 kB]
Get:153 http://127.0.0.1:9999/debian unstable/main amd64 glib-networking amd64 2.50.0-1+b1 [57.3 kB]
Get:154 http://127.0.0.1:9999/debian unstable/main amd64 libsoup2.4-1 amd64 2.56.0-2 [294 kB]
Get:155 http://127.0.0.1:9999/debian unstable/main amd64 libsoup-gnome2.4-1 amd64 2.56.0-2 [16.1 kB]
Get:156 http://127.0.0.1:9999/debian unstable/main amd64 librest-0.7-0 amd64 0.8.0-2 [33.0 kB]
Get:157 http://127.0.0.1:9999/debian unstable/main amd64 libwayland-client0 amd64 1.12.0-1 [24.8 kB]
Get:158 http://127.0.0.1:9999/debian unstable/main amd64 libwayland-cursor0 amd64 1.12.0-1 [13.2 kB]
Get:159 http://127.0.0.1:9999/debian unstable/main amd64 libwayland-server0 amd64 1.12.0-1 [30.4 kB]
Get:160 http://127.0.0.1:9999/debian unstable/main amd64 libgbm1 amd64 17.1.4-1 [61.3 kB]
Get:161 http://127.0.0.1:9999/debian unstable/main amd64 libegl1-mesa amd64 17.1.4-1 [115 kB]
Get:162 http://127.0.0.1:9999/debian unstable/main amd64 libwayland-egl1-mesa amd64 17.1.4-1 [43.5 kB]
Get:163 http://127.0.0.1:9999/debian unstable/main amd64 xkb-data all 2.19-1 [648 kB]
Get:164 http://127.0.0.1:9999/debian unstable/main amd64 libxkbcommon0 amd64 0.7.1-1 [122 kB]
Get:165 http://127.0.0.1:9999/debian unstable/main amd64 libgtk-3-0 amd64 3.22.16-1 [2527 kB]
Get:166 http://127.0.0.1:9999/debian unstable/main amd64 libfontenc1 amd64 1:1.1.3-1+b2 [24.4 kB]
Get:167 http://127.0.0.1:9999/debian unstable/main amd64 libice6 amd64 2:1.0.9-2 [58.7 kB]
Get:168 http://127.0.0.1:9999/debian unstable/main amd64 libsm6 amd64 2:1.2.2-1+b3 [33.3 kB]
Get:169 http://127.0.0.1:9999/debian unstable/main amd64 libxt6 amd64 1:1.1.5-1 [188 kB]
Get:170 http://127.0.0.1:9999/debian unstable/main amd64 libxmu6 amd64 2:1.1.2-2 [60.3 kB]
Get:171 http://127.0.0.1:9999/debian unstable/main amd64 libxpm4 amd64 1:3.5.12-1 [49.1 kB]
Get:172 http://127.0.0.1:9999/debian unstable/main amd64 libxaw7 amd64 2:1.0.13-1+b2 [201 kB]
Get:173 http://127.0.0.1:9999/debian unstable/main amd64 libxcb-shape0 amd64 1.12-1 [96.2 kB]
Get:174 http://127.0.0.1:9999/debian unstable/main amd64 libxft2 amd64 2.3.2-1+b2 [56.5 kB]
Get:175 http://127.0.0.1:9999/debian unstable/main amd64 libxmuu1 amd64 2:1.1.2-2 [23.5 kB]
Get:176 http://127.0.0.1:9999/debian unstable/main amd64 libxv1 amd64 2:1.0.11-1 [24.6 kB]
Get:177 http://127.0.0.1:9999/debian unstable/main amd64 libxxf86dga1 amd64 2:1.1.4-1+b3 [22.1 kB]
Get:178 http://127.0.0.1:9999/debian unstable/main amd64 x11-utils amd64 7.7+3+b1 [202 kB]
Get:179 http://127.0.0.1:9999/debian unstable/main amd64 libatk-wrapper-java all 0.33.3-13 [44.0 kB]
Get:180 http://127.0.0.1:9999/debian unstable/main amd64 libatk-wrapper-java-jni amd64 0.33.3-13 [37.2 kB]
Get:181 http://127.0.0.1:9999/debian unstable/main amd64 libasound2-data all 1.1.3-5 [173 kB]
Get:182 http://127.0.0.1:9999/debian unstable/main amd64 libasound2 amd64 1.1.3-5 [497 kB]
Get:183 http://127.0.0.1:9999/debian unstable/main amd64 libgif7 amd64 5.1.4-0.4 [43.1 kB]
Get:184 http://127.0.0.1:9999/debian unstable/main amd64 libasyncns0 amd64 0.8-6 [12.5 kB]
Get:185 http://127.0.0.1:9999/debian unstable/main amd64 libflac8 amd64 1.3.2-1 [221 kB]
Get:186 http://127.0.0.1:9999/debian unstable/main amd64 libvorbis0a amd64 1.3.5-4 [91.6 kB]
Get:187 http://127.0.0.1:9999/debian unstable/main amd64 libvorbisenc2 amd64 1.3.5-4 [79.0 kB]
Get:188 http://127.0.0.1:9999/debian unstable/main amd64 libsndfile1 amd64 1.0.28-2 [249 kB]
Get:189 http://127.0.0.1:9999/debian unstable/main amd64 libpulse0 amd64 10.0-2 [282 kB]
Get:190 http://127.0.0.1:9999/debian unstable/main amd64 openjdk-8-jre amd64 8u131-b11-2 [69.5 kB]
Get:191 http://127.0.0.1:9999/debian unstable/main amd64 default-jre amd64 2:1.8-59 [934 B]
Get:192 http://127.0.0.1:9999/debian unstable/main amd64 openjdk-8-jdk-headless amd64 8u131-b11-2 [8168 kB]
Get:193 http://127.0.0.1:9999/debian unstable/main amd64 default-jdk-headless amd64 2:1.8-59 [996 B]
Get:194 http://127.0.0.1:9999/debian unstable/main amd64 openjdk-8-jdk amd64 8u131-b11-2 [454 kB]
Get:195 http://127.0.0.1:9999/debian unstable/main amd64 default-jdk amd64 2:1.8-59 [930 B]
Get:196 http://127.0.0.1:9999/debian unstable/main amd64 libfile-which-perl all 1.21-1 [14.3 kB]
Get:197 http://127.0.0.1:9999/debian unstable/main amd64 libfile-homedir-perl all 1.00-1 [48.9 kB]
Get:198 http://127.0.0.1:9999/debian unstable/main amd64 devscripts amd64 2.17.6 [937 kB]
Get:199 http://127.0.0.1:9999/debian unstable/main amd64 jaligner all 1.0+dfsg-4 [128 kB]
Get:200 http://127.0.0.1:9999/debian unstable/main amd64 javahelper all 0.61 [84.8 kB]
Get:201 http://127.0.0.1:9999/debian unstable/main amd64 libjellyfish-2.0-2 amd64 2.2.6-1+b2 [62.2 kB]
Get:202 http://127.0.0.1:9999/debian unstable/main amd64 jellyfish amd64 2.2.6-1+b2 [349 kB]
Get:203 http://127.0.0.1:9999/debian unstable/main amd64 libconcurrent-java all 1.3.4-4 [133 kB]
Get:204 http://127.0.0.1:9999/debian unstable/main amd64 libcolt-free-java all 1.2.0+dfsg-4 [405 kB]
Get:205 http://127.0.0.1:9999/debian unstable/main amd64 libcommons-collections4-java all 4.1-1 [656 kB]
Get:206 http://127.0.0.1:9999/debian unstable/main amd64 libnghttp2-14 amd64 1.24.0-1 [81.6 kB]
Get:207 http://127.0.0.1:9999/debian unstable/main amd64 libpsl5 amd64 0.17.0-4+b1 [43.0 kB]
Get:208 http://127.0.0.1:9999/debian unstable/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-1+b1 [60.4 kB]
Get:209 http://127.0.0.1:9999/debian unstable/main amd64 libssh2-1 amd64 1.8.0-1 [138 kB]
Get:210 http://127.0.0.1:9999/debian unstable/main amd64 libcurl3-gnutls amd64 7.52.1-5 [289 kB]
Get:211 http://127.0.0.1:9999/debian unstable/main amd64 libgetopt-java all 1.0.14+dfsg-3 [24.9 kB]
Get:212 http://127.0.0.1:9999/debian unstable/main amd64 libhts2 amd64 1.4.1-2 [294 kB]
Get:213 http://127.0.0.1:9999/debian unstable/main amd64 libhts-dev amd64 1.4.1-2 [398 kB]
Get:214 http://127.0.0.1:9999/debian unstable/main amd64 libjs-jquery all 3.1.1-2 [154 kB]
Get:215 http://127.0.0.1:9999/debian unstable/main amd64 libvecmath-java all 1.5.2-6 [92.4 kB]
Get:216 http://127.0.0.1:9999/debian unstable/main amd64 libjung-free-java all 2.0.1+dfsg-1 [976 kB]
Get:217 http://127.0.0.1:9999/debian unstable/main amd64 parafly amd64 0.0.2013.01.21-3+b1 [16.4 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 122 MB in 1s (82.7 MB/s)
Selecting previously unselected package groff-base.
(Reading database ... 10178 files and directories currently installed.)
Preparing to unpack .../00-groff-base_1.22.3-9_amd64.deb ...
Unpacking groff-base (1.22.3-9) ...
Selecting previously unselected package bsdmainutils.
Preparing to unpack .../01-bsdmainutils_9.0.12+nmu1_amd64.deb ...
Unpacking bsdmainutils (9.0.12+nmu1) ...
Selecting previously unselected package libpipeline1:amd64.
Preparing to unpack .../02-libpipeline1_1.4.1-2_amd64.deb ...
Unpacking libpipeline1:amd64 (1.4.1-2) ...
Selecting previously unselected package man-db.
Preparing to unpack .../03-man-db_2.7.6.1-2_amd64.deb ...
Unpacking man-db (2.7.6.1-2) ...
Selecting previously unselected package libexpat1:amd64.
Preparing to unpack .../04-libexpat1_2.2.1-3_amd64.deb ...
Unpacking libexpat1:amd64 (2.2.1-3) ...
Selecting previously unselected package libpng16-16:amd64.
Preparing to unpack .../05-libpng16-16_1.6.29-3_amd64.deb ...
Unpacking libpng16-16:amd64 (1.6.29-3) ...
Selecting previously unselected package libfreetype6:amd64.
Preparing to unpack .../06-libfreetype6_2.8-0.2_amd64.deb ...
Unpacking libfreetype6:amd64 (2.8-0.2) ...
Selecting previously unselected package ucf.
Preparing to unpack .../07-ucf_3.0036_all.deb ...
Moving old data out of the way
Unpacking ucf (3.0036) ...
Selecting previously unselected package fonts-dejavu-core.
Preparing to unpack .../08-fonts-dejavu-core_2.37-1_all.deb ...
Unpacking fonts-dejavu-core (2.37-1) ...
Selecting previously unselected package fontconfig-config.
Preparing to unpack .../09-fontconfig-config_2.12.3-0.1_all.deb ...
Unpacking fontconfig-config (2.12.3-0.1) ...
Selecting previously unselected package libfontconfig1:amd64.
Preparing to unpack .../10-libfontconfig1_2.12.3-0.1_amd64.deb ...
Unpacking libfontconfig1:amd64 (2.12.3-0.1) ...
Selecting previously unselected package fontconfig.
Preparing to unpack .../11-fontconfig_2.12.3-0.1_amd64.deb ...
Unpacking fontconfig (2.12.3-0.1) ...
Selecting previously unselected package libogg0:amd64.
Preparing to unpack .../12-libogg0_1.3.2-1_amd64.deb ...
Unpacking libogg0:amd64 (1.3.2-1) ...
Selecting previously unselected package libxau6:amd64.
Preparing to unpack .../13-libxau6_1%3a1.0.8-1_amd64.deb ...
Unpacking libxau6:amd64 (1:1.0.8-1) ...
Selecting previously unselected package libssl1.1:amd64.
Preparing to unpack .../14-libssl1.1_1.1.0f-3_amd64.deb ...
Unpacking libssl1.1:amd64 (1.1.0f-3) ...
Selecting previously unselected package openssl.
Preparing to unpack .../15-openssl_1.1.0f-3_amd64.deb ...
Unpacking openssl (1.1.0f-3) ...
Selecting previously unselected package ca-certificates.
Preparing to unpack .../16-ca-certificates_20161130+nmu1_all.deb ...
Unpacking ca-certificates (20161130+nmu1) ...
Selecting previously unselected package java-common.
Preparing to unpack .../17-java-common_0.59_all.deb ...
Unpacking java-common (0.59) ...
Selecting previously unselected package default-jre-headless.
Preparing to unpack .../18-default-jre-headless_2%3a1.8-59_amd64.deb ...
Unpacking default-jre-headless (2:1.8-59) ...
Selecting previously unselected package libnspr4:amd64.
Preparing to unpack .../19-libnspr4_2%3a4.15-1_amd64.deb ...
Unpacking libnspr4:amd64 (2:4.15-1) ...
Selecting previously unselected package libsqlite3-0:amd64.
Preparing to unpack .../20-libsqlite3-0_3.16.2-5_amd64.deb ...
Unpacking libsqlite3-0:amd64 (3.16.2-5) ...
Selecting previously unselected package libnss3:amd64.
Preparing to unpack .../21-libnss3_2%3a3.31-1_amd64.deb ...
Unpacking libnss3:amd64 (2:3.31-1) ...
Selecting previously unselected package ca-certificates-java.
Preparing to unpack .../22-ca-certificates-java_20170531+nmu1_all.deb ...
Unpacking ca-certificates-java (20170531+nmu1) ...
Selecting previously unselected package libavahi-common-data:amd64.
Preparing to unpack .../23-libavahi-common-data_0.6.32-2_amd64.deb ...
Unpacking libavahi-common-data:amd64 (0.6.32-2) ...
Selecting previously unselected package libavahi-common3:amd64.
Preparing to unpack .../24-libavahi-common3_0.6.32-2_amd64.deb ...
Unpacking libavahi-common3:amd64 (0.6.32-2) ...
Selecting previously unselected package libdbus-1-3:amd64.
Preparing to unpack .../25-libdbus-1-3_1.10.20-1_amd64.deb ...
Unpacking libdbus-1-3:amd64 (1.10.20-1) ...
Selecting previously unselected package libavahi-client3:amd64.
Preparing to unpack .../26-libavahi-client3_0.6.32-2_amd64.deb ...
Unpacking libavahi-client3:amd64 (0.6.32-2) ...
Selecting previously unselected package libkeyutils1:amd64.
Preparing to unpack .../27-libkeyutils1_1.5.9-9_amd64.deb ...
Unpacking libkeyutils1:amd64 (1.5.9-9) ...
Selecting previously unselected package libkrb5support0:amd64.
Preparing to unpack .../28-libkrb5support0_1.15-1_amd64.deb ...
Unpacking libkrb5support0:amd64 (1.15-1) ...
Selecting previously unselected package libk5crypto3:amd64.
Preparing to unpack .../29-libk5crypto3_1.15-1_amd64.deb ...
Unpacking libk5crypto3:amd64 (1.15-1) ...
Selecting previously unselected package libkrb5-3:amd64.
Preparing to unpack .../30-libkrb5-3_1.15-1_amd64.deb ...
Unpacking libkrb5-3:amd64 (1.15-1) ...
Selecting previously unselected package libgssapi-krb5-2:amd64.
Preparing to unpack .../31-libgssapi-krb5-2_1.15-1_amd64.deb ...
Unpacking libgssapi-krb5-2:amd64 (1.15-1) ...
Selecting previously unselected package libcups2:amd64.
Preparing to unpack .../32-libcups2_2.2.4-1_amd64.deb ...
Unpacking libcups2:amd64 (2.2.4-1) ...
Selecting previously unselected package liblcms2-2:amd64.
Preparing to unpack .../33-liblcms2-2_2.8-4_amd64.deb ...
Unpacking liblcms2-2:amd64 (2.8-4) ...
Selecting previously unselected package libjpeg62-turbo:amd64.
Preparing to unpack .../34-libjpeg62-turbo_1%3a1.5.1-2_amd64.deb ...
Unpacking libjpeg62-turbo:amd64 (1:1.5.1-2) ...
Selecting previously unselected package libpcsclite1:amd64.
Preparing to unpack .../35-libpcsclite1_1.8.22-1_amd64.deb ...
Unpacking libpcsclite1:amd64 (1.8.22-1) ...
Selecting previously unselected package libxdmcp6:amd64.
Preparing to unpack .../36-libxdmcp6_1%3a1.1.2-3_amd64.deb ...
Unpacking libxdmcp6:amd64 (1:1.1.2-3) ...
Selecting previously unselected package libxcb1:amd64.
Preparing to unpack .../37-libxcb1_1.12-1_amd64.deb ...
Unpacking libxcb1:amd64 (1.12-1) ...
Selecting previously unselected package libx11-data.
Preparing to unpack .../38-libx11-data_2%3a1.6.4-3_all.deb ...
Unpacking libx11-data (2:1.6.4-3) ...
Selecting previously unselected package libx11-6:amd64.
Preparing to unpack .../39-libx11-6_2%3a1.6.4-3_amd64.deb ...
Unpacking libx11-6:amd64 (2:1.6.4-3) ...
Selecting previously unselected package libxext6:amd64.
Preparing to unpack .../40-libxext6_2%3a1.3.3-1+b2_amd64.deb ...
Unpacking libxext6:amd64 (2:1.3.3-1+b2) ...
Selecting previously unselected package libxi6:amd64.
Preparing to unpack .../41-libxi6_2%3a1.7.9-1_amd64.deb ...
Unpacking libxi6:amd64 (2:1.7.9-1) ...
Selecting previously unselected package libxrender1:amd64.
Preparing to unpack .../42-libxrender1_1%3a0.9.10-1_amd64.deb ...
Unpacking libxrender1:amd64 (1:0.9.10-1) ...
Selecting previously unselected package lsb-base.
Preparing to unpack .../43-lsb-base_9.20161125_all.deb ...
Unpacking lsb-base (9.20161125) ...
Selecting previously unselected package x11-common.
Preparing to unpack .../44-x11-common_1%3a7.7+19_all.deb ...
Unpacking x11-common (1:7.7+19) ...
Selecting previously unselected package libxtst6:amd64.
Preparing to unpack .../45-libxtst6_2%3a1.2.3-1_amd64.deb ...
Unpacking libxtst6:amd64 (2:1.2.3-1) ...
Selecting previously unselected package openjdk-8-jre-headless:amd64.
Preparing to unpack .../46-openjdk-8-jre-headless_8u131-b11-2_amd64.deb ...
Unpacking openjdk-8-jre-headless:amd64 (8u131-b11-2) ...
Selecting previously unselected package libpython3.5-minimal:amd64.
Preparing to unpack .../47-libpython3.5-minimal_3.5.3-3_amd64.deb ...
Unpacking libpython3.5-minimal:amd64 (3.5.3-3) ...
Selecting previously unselected package python3.5-minimal.
Preparing to unpack .../48-python3.5-minimal_3.5.3-3_amd64.deb ...
Unpacking python3.5-minimal (3.5.3-3) ...
Selecting previously unselected package python3-minimal.
Preparing to unpack .../49-python3-minimal_3.5.3-3_amd64.deb ...
Unpacking python3-minimal (3.5.3-3) ...
Selecting previously unselected package mime-support.
Preparing to unpack .../50-mime-support_3.60_all.deb ...
Unpacking mime-support (3.60) ...
Selecting previously unselected package libmpdec2:amd64.
Preparing to unpack .../51-libmpdec2_2.4.2-1_amd64.deb ...
Unpacking libmpdec2:amd64 (2.4.2-1) ...
Selecting previously unselected package readline-common.
Preparing to unpack .../52-readline-common_7.0-3_all.deb ...
Unpacking readline-common (7.0-3) ...
Selecting previously unselected package libreadline7:amd64.
Preparing to unpack .../53-libreadline7_7.0-3_amd64.deb ...
Unpacking libreadline7:amd64 (7.0-3) ...
Selecting previously unselected package libpython3.5-stdlib:amd64.
Preparing to unpack .../54-libpython3.5-stdlib_3.5.3-3_amd64.deb ...
Unpacking libpython3.5-stdlib:amd64 (3.5.3-3) ...
Selecting previously unselected package python3.5.
Preparing to unpack .../55-python3.5_3.5.3-3_amd64.deb ...
Unpacking python3.5 (3.5.3-3) ...
Selecting previously unselected package libpython3-stdlib:amd64.
Preparing to unpack .../56-libpython3-stdlib_3.5.3-3_amd64.deb ...
Unpacking libpython3-stdlib:amd64 (3.5.3-3) ...
Selecting previously unselected package dh-python.
Preparing to unpack .../57-dh-python_2.20170125_all.deb ...
Unpacking dh-python (2.20170125) ...
Setting up libssl1.1:amd64 (1.1.0f-3) ...
Setting up libpython3.5-minimal:amd64 (3.5.3-3) ...
Setting up libexpat1:amd64 (2.2.1-3) ...
Setting up python3.5-minimal (3.5.3-3) ...
Setting up python3-minimal (3.5.3-3) ...
Selecting previously unselected package python3.
(Reading database ... 12997 files and directories currently installed.)
Preparing to unpack .../000-python3_3.5.3-3_amd64.deb ...
Unpacking python3 (3.5.3-3) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../001-libmagic-mgc_1%3a5.30-1_amd64.deb ...
Unpacking libmagic-mgc (1:5.30-1) ...
Selecting previously unselected package libmagic1:amd64.
Preparing to unpack .../002-libmagic1_1%3a5.30-1_amd64.deb ...
Unpacking libmagic1:amd64 (1:5.30-1) ...
Selecting previously unselected package file.
Preparing to unpack .../003-file_1%3a5.30-1_amd64.deb ...
Unpacking file (1:5.30-1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../004-gettext-base_0.19.8.1-2+b1_amd64.deb ...
Unpacking gettext-base (0.19.8.1-2+b1) ...
Selecting previously unselected package libcap2:amd64.
Preparing to unpack .../005-libcap2_1%3a2.25-1_amd64.deb ...
Unpacking libcap2:amd64 (1:2.25-1) ...
Selecting previously unselected package libsasl2-modules-db:amd64.
Preparing to unpack .../006-libsasl2-modules-db_2.1.27~101-g0780600+dfsg-3_amd64.deb ...
Unpacking libsasl2-modules-db:amd64 (2.1.27~101-g0780600+dfsg-3) ...
Selecting previously unselected package libsasl2-2:amd64.
Preparing to unpack .../007-libsasl2-2_2.1.27~101-g0780600+dfsg-3_amd64.deb ...
Unpacking libsasl2-2:amd64 (2.1.27~101-g0780600+dfsg-3) ...
Selecting previously unselected package libldap-common.
Preparing to unpack .../008-libldap-common_2.4.44+dfsg-7_all.deb ...
Unpacking libldap-common (2.4.44+dfsg-7) ...
Selecting previously unselected package libldap-2.4-2:amd64.
Preparing to unpack .../009-libldap-2.4-2_2.4.44+dfsg-7_amd64.deb ...
Unpacking libldap-2.4-2:amd64 (2.4.44+dfsg-7) ...
Selecting previously unselected package libwrap0:amd64.
Preparing to unpack .../010-libwrap0_7.6.q-26_amd64.deb ...
Unpacking libwrap0:amd64 (7.6.q-26) ...
Selecting previously unselected package libicu57:amd64.
Preparing to unpack .../011-libicu57_57.1-6_amd64.deb ...
Unpacking libicu57:amd64 (57.1-6) ...
Selecting previously unselected package libxml2:amd64.
Preparing to unpack .../012-libxml2_2.9.4+dfsg1-3_amd64.deb ...
Unpacking libxml2:amd64 (2.9.4+dfsg1-3) ...
Selecting previously unselected package hicolor-icon-theme.
Preparing to unpack .../013-hicolor-icon-theme_0.15-1_all.deb ...
Unpacking hicolor-icon-theme (0.15-1) ...
Selecting previously unselected package libglib2.0-0:amd64.
Preparing to unpack .../014-libglib2.0-0_2.52.3-1_amd64.deb ...
Unpacking libglib2.0-0:amd64 (2.52.3-1) ...
Selecting previously unselected package libjbig0:amd64.
Preparing to unpack .../015-libjbig0_2.1-3.1+b2_amd64.deb ...
Unpacking libjbig0:amd64 (2.1-3.1+b2) ...
Selecting previously unselected package libtiff5:amd64.
Preparing to unpack .../016-libtiff5_4.0.8-3_amd64.deb ...
Unpacking libtiff5:amd64 (4.0.8-3) ...
Selecting previously unselected package shared-mime-info.
Preparing to unpack .../017-shared-mime-info_1.8-1_amd64.deb ...
Unpacking shared-mime-info (1.8-1) ...
Selecting previously unselected package libgdk-pixbuf2.0-common.
Preparing to unpack .../018-libgdk-pixbuf2.0-common_2.36.5-2_all.deb ...
Unpacking libgdk-pixbuf2.0-common (2.36.5-2) ...
Selecting previously unselected package libgdk-pixbuf2.0-0:amd64.
Preparing to unpack .../019-libgdk-pixbuf2.0-0_2.36.5-2_amd64.deb ...
Unpacking libgdk-pixbuf2.0-0:amd64 (2.36.5-2) ...
Selecting previously unselected package gtk-update-icon-cache.
Preparing to unpack .../020-gtk-update-icon-cache_3.22.16-1_amd64.deb ...
No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed.
No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed.
Unpacking gtk-update-icon-cache (3.22.16-1) ...
Selecting previously unselected package libpixman-1-0:amd64.
Preparing to unpack .../021-libpixman-1-0_0.34.0-1_amd64.deb ...
Unpacking libpixman-1-0:amd64 (0.34.0-1) ...
Selecting previously unselected package libxcb-render0:amd64.
Preparing to unpack .../022-libxcb-render0_1.12-1_amd64.deb ...
Unpacking libxcb-render0:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-shm0:amd64.
Preparing to unpack .../023-libxcb-shm0_1.12-1_amd64.deb ...
Unpacking libxcb-shm0:amd64 (1.12-1) ...
Selecting previously unselected package libcairo2:amd64.
Preparing to unpack .../024-libcairo2_1.14.10-1_amd64.deb ...
Unpacking libcairo2:amd64 (1.14.10-1) ...
Selecting previously unselected package libcroco3:amd64.
Preparing to unpack .../025-libcroco3_0.6.12-1_amd64.deb ...
Unpacking libcroco3:amd64 (0.6.12-1) ...
Selecting previously unselected package libthai-data.
Preparing to unpack .../026-libthai-data_0.1.26-1_all.deb ...
Unpacking libthai-data (0.1.26-1) ...
Selecting previously unselected package libdatrie1:amd64.
Preparing to unpack .../027-libdatrie1_0.2.10-4+b1_amd64.deb ...
Unpacking libdatrie1:amd64 (0.2.10-4+b1) ...
Selecting previously unselected package libthai0:amd64.
Preparing to unpack .../028-libthai0_0.1.26-1_amd64.deb ...
Unpacking libthai0:amd64 (0.1.26-1) ...
Selecting previously unselected package libpango-1.0-0:amd64.
Preparing to unpack .../029-libpango-1.0-0_1.40.6-1_amd64.deb ...
Unpacking libpango-1.0-0:amd64 (1.40.6-1) ...
Selecting previously unselected package libgraphite2-3:amd64.
Preparing to unpack .../030-libgraphite2-3_1.3.10-2_amd64.deb ...
Unpacking libgraphite2-3:amd64 (1.3.10-2) ...
Selecting previously unselected package libharfbuzz0b:amd64.
Preparing to unpack .../031-libharfbuzz0b_1.4.2-1_amd64.deb ...
Unpacking libharfbuzz0b:amd64 (1.4.2-1) ...
Selecting previously unselected package libpangoft2-1.0-0:amd64.
Preparing to unpack .../032-libpangoft2-1.0-0_1.40.6-1_amd64.deb ...
Unpacking libpangoft2-1.0-0:amd64 (1.40.6-1) ...
Selecting previously unselected package libpangocairo-1.0-0:amd64.
Preparing to unpack .../033-libpangocairo-1.0-0_1.40.6-1_amd64.deb ...
Unpacking libpangocairo-1.0-0:amd64 (1.40.6-1) ...
Selecting previously unselected package librsvg2-2:amd64.
Preparing to unpack .../034-librsvg2-2_2.40.16-1+b1_amd64.deb ...
Unpacking librsvg2-2:amd64 (2.40.16-1+b1) ...
Selecting previously unselected package librsvg2-common:amd64.
Preparing to unpack .../035-librsvg2-common_2.40.16-1+b1_amd64.deb ...
Unpacking librsvg2-common:amd64 (2.40.16-1+b1) ...
Selecting previously unselected package adwaita-icon-theme.
Preparing to unpack .../036-adwaita-icon-theme_3.22.0-1_all.deb ...
Unpacking adwaita-icon-theme (3.22.0-1) ...
Selecting previously unselected package libsigsegv2:amd64.
Preparing to unpack .../037-libsigsegv2_2.11-1_amd64.deb ...
Unpacking libsigsegv2:amd64 (2.11-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../038-m4_1.4.18-1_amd64.deb ...
Unpacking m4 (1.4.18-1) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../039-autoconf_2.69-10_all.deb ...
Unpacking autoconf (2.69-10) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../040-autotools-dev_20161112.1_all.deb ...
Unpacking autotools-dev (20161112.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../041-automake_1%3a1.15.1-2_all.deb ...
Unpacking automake (1:1.15.1-2) ...
Selecting previously unselected package automake1.11.
Preparing to unpack .../042-automake1.11_1%3a1.11.6-4_all.deb ...
Unpacking automake1.11 (1:1.11.6-4) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../043-autopoint_0.19.8.1-2_all.deb ...
Unpacking autopoint (0.19.8.1-2) ...
Selecting previously unselected package libdconf1:amd64.
Preparing to unpack .../044-libdconf1_0.26.0-2+b1_amd64.deb ...
Unpacking libdconf1:amd64 (0.26.0-2+b1) ...
Selecting previously unselected package dconf-service.
Preparing to unpack .../045-dconf-service_0.26.0-2+b1_amd64.deb ...
Unpacking dconf-service (0.26.0-2+b1) ...
Selecting previously unselected package dconf-gsettings-backend:amd64.
Preparing to unpack .../046-dconf-gsettings-backend_0.26.0-2+b1_amd64.deb ...
Unpacking dconf-gsettings-backend:amd64 (0.26.0-2+b1) ...
Selecting previously unselected package dctrl-tools.
Preparing to unpack .../047-dctrl-tools_2.24-2+b1_amd64.deb ...
Unpacking dctrl-tools (2.24-2+b1) ...
Selecting previously unselected package libtool.
Preparing to unpack .../048-libtool_2.4.6-2_all.deb ...
Unpacking libtool (2.4.6-2) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../049-dh-autoreconf_14_all.deb ...
Unpacking dh-autoreconf (14) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../050-libarchive-zip-perl_1.59-1_all.deb ...
Unpacking libarchive-zip-perl (1.59-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../051-libfile-stripnondeterminism-perl_0.035-2_all.deb ...
Unpacking libfile-stripnondeterminism-perl (0.035-2) ...
Selecting previously unselected package libtimedate-perl.
Preparing to unpack .../052-libtimedate-perl_2.3000-2_all.deb ...
Unpacking libtimedate-perl (2.3000-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../053-dh-strip-nondeterminism_0.035-2_all.deb ...
Unpacking dh-strip-nondeterminism (0.035-2) ...
Selecting previously unselected package gettext.
Preparing to unpack .../054-gettext_0.19.8.1-2+b1_amd64.deb ...
Unpacking gettext (0.19.8.1-2+b1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../055-intltool-debian_0.35.0+20060710.4_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.4) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../056-po-debconf_1.0.20_all.deb ...
Unpacking po-debconf (1.0.20) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../057-debhelper_10.6.2_all.deb ...
Unpacking debhelper (10.6.2) ...
Selecting previously unselected package libgtk2.0-common.
Preparing to unpack .../058-libgtk2.0-common_2.24.31-2_all.deb ...
Unpacking libgtk2.0-common (2.24.31-2) ...
Selecting previously unselected package libatk1.0-data.
Preparing to unpack .../059-libatk1.0-data_2.22.0-1_all.deb ...
Unpacking libatk1.0-data (2.22.0-1) ...
Selecting previously unselected package libatk1.0-0:amd64.
Preparing to unpack .../060-libatk1.0-0_2.22.0-1_amd64.deb ...
Unpacking libatk1.0-0:amd64 (2.22.0-1) ...
Selecting previously unselected package libxcomposite1:amd64.
Preparing to unpack .../061-libxcomposite1_1%3a0.4.4-2_amd64.deb ...
Unpacking libxcomposite1:amd64 (1:0.4.4-2) ...
Selecting previously unselected package libxfixes3:amd64.
Preparing to unpack .../062-libxfixes3_1%3a5.0.3-1_amd64.deb ...
Unpacking libxfixes3:amd64 (1:5.0.3-1) ...
Selecting previously unselected package libxcursor1:amd64.
Preparing to unpack .../063-libxcursor1_1%3a1.1.14-1+b4_amd64.deb ...
Unpacking libxcursor1:amd64 (1:1.1.14-1+b4) ...
Selecting previously unselected package libxdamage1:amd64.
Preparing to unpack .../064-libxdamage1_1%3a1.1.4-2+b3_amd64.deb ...
Unpacking libxdamage1:amd64 (1:1.1.4-2+b3) ...
Selecting previously unselected package libxinerama1:amd64.
Preparing to unpack .../065-libxinerama1_2%3a1.1.3-1+b3_amd64.deb ...
Unpacking libxinerama1:amd64 (2:1.1.3-1+b3) ...
Selecting previously unselected package libxrandr2:amd64.
Preparing to unpack .../066-libxrandr2_2%3a1.5.1-1_amd64.deb ...
Unpacking libxrandr2:amd64 (2:1.5.1-1) ...
Selecting previously unselected package gnome-icon-theme.
Preparing to unpack .../067-gnome-icon-theme_3.12.0-2_all.deb ...
Unpacking gnome-icon-theme (3.12.0-2) ...
Selecting previously unselected package libgtk2.0-0:amd64.
Preparing to unpack .../068-libgtk2.0-0_2.24.31-2_amd64.deb ...
Unpacking libgtk2.0-0:amd64 (2.24.31-2) ...
Selecting previously unselected package libdrm2:amd64.
Preparing to unpack .../069-libdrm2_2.4.81-2_amd64.deb ...
Unpacking libdrm2:amd64 (2.4.81-2) ...
Selecting previously unselected package libglapi-mesa:amd64.
Preparing to unpack .../070-libglapi-mesa_17.1.4-1_amd64.deb ...
Unpacking libglapi-mesa:amd64 (17.1.4-1) ...
Selecting previously unselected package libx11-xcb1:amd64.
Preparing to unpack .../071-libx11-xcb1_2%3a1.6.4-3_amd64.deb ...
Unpacking libx11-xcb1:amd64 (2:1.6.4-3) ...
Selecting previously unselected package libxcb-dri2-0:amd64.
Preparing to unpack .../072-libxcb-dri2-0_1.12-1_amd64.deb ...
Unpacking libxcb-dri2-0:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-dri3-0:amd64.
Preparing to unpack .../073-libxcb-dri3-0_1.12-1_amd64.deb ...
Unpacking libxcb-dri3-0:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-glx0:amd64.
Preparing to unpack .../074-libxcb-glx0_1.12-1_amd64.deb ...
Unpacking libxcb-glx0:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-present0:amd64.
Preparing to unpack .../075-libxcb-present0_1.12-1_amd64.deb ...
Unpacking libxcb-present0:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-sync1:amd64.
Preparing to unpack .../076-libxcb-sync1_1.12-1_amd64.deb ...
Unpacking libxcb-sync1:amd64 (1.12-1) ...
Selecting previously unselected package libxcb-xfixes0:amd64.
Preparing to unpack .../077-libxcb-xfixes0_1.12-1_amd64.deb ...
Unpacking libxcb-xfixes0:amd64 (1.12-1) ...
Selecting previously unselected package libxshmfence1:amd64.
Preparing to unpack .../078-libxshmfence1_1.2-1+b2_amd64.deb ...
Unpacking libxshmfence1:amd64 (1.2-1+b2) ...
Selecting previously unselected package libxxf86vm1:amd64.
Preparing to unpack .../079-libxxf86vm1_1%3a1.1.4-1+b2_amd64.deb ...
Unpacking libxxf86vm1:amd64 (1:1.1.4-1+b2) ...
Selecting previously unselected package libgl1-mesa-glx:amd64.
Preparing to unpack .../080-libgl1-mesa-glx_17.1.4-1_amd64.deb ...
Unpacking libgl1-mesa-glx:amd64 (17.1.4-1) ...
Selecting previously unselected package libatspi2.0-0:amd64.
Preparing to unpack .../081-libatspi2.0-0_2.24.1-1_amd64.deb ...
Unpacking libatspi2.0-0:amd64 (2.24.1-1) ...
Selecting previously unselected package libatk-bridge2.0-0:amd64.
Preparing to unpack .../082-libatk-bridge2.0-0_2.24.1-1_amd64.deb ...
Unpacking libatk-bridge2.0-0:amd64 (2.24.1-1) ...
Selecting previously unselected package libcairo-gobject2:amd64.
Preparing to unpack .../083-libcairo-gobject2_1.14.10-1_amd64.deb ...
Unpacking libcairo-gobject2:amd64 (1.14.10-1) ...
Selecting previously unselected package libgtk-3-common.
Preparing to unpack .../084-libgtk-3-common_3.22.16-1_all.deb ...
Unpacking libgtk-3-common (3.22.16-1) ...
Selecting previously unselected package libcolord2:amd64.
Preparing to unpack .../085-libcolord2_1.3.3-2_amd64.deb ...
Unpacking libcolord2:amd64 (1.3.3-2) ...
Selecting previously unselected package libepoxy0:amd64.
Preparing to unpack .../086-libepoxy0_1.3.1-3_amd64.deb ...
Unpacking libepoxy0:amd64 (1.3.1-3) ...
Selecting previously unselected package libjson-glib-1.0-common.
Preparing to unpack .../087-libjson-glib-1.0-common_1.2.8-1_all.deb ...
Unpacking libjson-glib-1.0-common (1.2.8-1) ...
Selecting previously unselected package libjson-glib-1.0-0:amd64.
Preparing to unpack .../088-libjson-glib-1.0-0_1.2.8-1_amd64.deb ...
Unpacking libjson-glib-1.0-0:amd64 (1.2.8-1) ...
Selecting previously unselected package libproxy1v5:amd64.
Preparing to unpack .../089-libproxy1v5_0.4.14-3_amd64.deb ...
Unpacking libproxy1v5:amd64 (0.4.14-3) ...
Selecting previously unselected package glib-networking-common.
Preparing to unpack .../090-glib-networking-common_2.50.0-1_all.deb ...
Unpacking glib-networking-common (2.50.0-1) ...
Selecting previously unselected package glib-networking-services.
Preparing to unpack .../091-glib-networking-services_2.50.0-1+b1_amd64.deb ...
Unpacking glib-networking-services (2.50.0-1+b1) ...
Selecting previously unselected package gsettings-desktop-schemas.
Preparing to unpack .../092-gsettings-desktop-schemas_3.22.0-1_all.deb ...
Unpacking gsettings-desktop-schemas (3.22.0-1) ...
Selecting previously unselected package glib-networking:amd64.
Preparing to unpack .../093-glib-networking_2.50.0-1+b1_amd64.deb ...
Unpacking glib-networking:amd64 (2.50.0-1+b1) ...
Selecting previously unselected package libsoup2.4-1:amd64.
Preparing to unpack .../094-libsoup2.4-1_2.56.0-2_amd64.deb ...
Unpacking libsoup2.4-1:amd64 (2.56.0-2) ...
Selecting previously unselected package libsoup-gnome2.4-1:amd64.
Preparing to unpack .../095-libsoup-gnome2.4-1_2.56.0-2_amd64.deb ...
Unpacking libsoup-gnome2.4-1:amd64 (2.56.0-2) ...
Selecting previously unselected package librest-0.7-0:amd64.
Preparing to unpack .../096-librest-0.7-0_0.8.0-2_amd64.deb ...
Unpacking librest-0.7-0:amd64 (0.8.0-2) ...
Selecting previously unselected package libwayland-client0:amd64.
Preparing to unpack .../097-libwayland-client0_1.12.0-1_amd64.deb ...
Unpacking libwayland-client0:amd64 (1.12.0-1) ...
Selecting previously unselected package libwayland-cursor0:amd64.
Preparing to unpack .../098-libwayland-cursor0_1.12.0-1_amd64.deb ...
Unpacking libwayland-cursor0:amd64 (1.12.0-1) ...
Selecting previously unselected package libwayland-server0:amd64.
Preparing to unpack .../099-libwayland-server0_1.12.0-1_amd64.deb ...
Unpacking libwayland-server0:amd64 (1.12.0-1) ...
Selecting previously unselected package libgbm1:amd64.
Preparing to unpack .../100-libgbm1_17.1.4-1_amd64.deb ...
Unpacking libgbm1:amd64 (17.1.4-1) ...
Selecting previously unselected package libegl1-mesa:amd64.
Preparing to unpack .../101-libegl1-mesa_17.1.4-1_amd64.deb ...
Unpacking libegl1-mesa:amd64 (17.1.4-1) ...
Selecting previously unselected package libwayland-egl1-mesa:amd64.
Preparing to unpack .../102-libwayland-egl1-mesa_17.1.4-1_amd64.deb ...
Unpacking libwayland-egl1-mesa:amd64 (17.1.4-1) ...
Selecting previously unselected package xkb-data.
Preparing to unpack .../103-xkb-data_2.19-1_all.deb ...
Unpacking xkb-data (2.19-1) ...
Selecting previously unselected package libxkbcommon0:amd64.
Preparing to unpack .../104-libxkbcommon0_0.7.1-1_amd64.deb ...
Unpacking libxkbcommon0:amd64 (0.7.1-1) ...
Selecting previously unselected package libgtk-3-0:amd64.
Preparing to unpack .../105-libgtk-3-0_3.22.16-1_amd64.deb ...
Unpacking libgtk-3-0:amd64 (3.22.16-1) ...
Selecting previously unselected package libfontenc1:amd64.
Preparing to unpack .../106-libfontenc1_1%3a1.1.3-1+b2_amd64.deb ...
Unpacking libfontenc1:amd64 (1:1.1.3-1+b2) ...
Selecting previously unselected package libice6:amd64.
Preparing to unpack .../107-libice6_2%3a1.0.9-2_amd64.deb ...
Unpacking libice6:amd64 (2:1.0.9-2) ...
Selecting previously unselected package libsm6:amd64.
Preparing to unpack .../108-libsm6_2%3a1.2.2-1+b3_amd64.deb ...
Unpacking libsm6:amd64 (2:1.2.2-1+b3) ...
Selecting previously unselected package libxt6:amd64.
Preparing to unpack .../109-libxt6_1%3a1.1.5-1_amd64.deb ...
Unpacking libxt6:amd64 (1:1.1.5-1) ...
Selecting previously unselected package libxmu6:amd64.
Preparing to unpack .../110-libxmu6_2%3a1.1.2-2_amd64.deb ...
Unpacking libxmu6:amd64 (2:1.1.2-2) ...
Selecting previously unselected package libxpm4:amd64.
Preparing to unpack .../111-libxpm4_1%3a3.5.12-1_amd64.deb ...
Unpacking libxpm4:amd64 (1:3.5.12-1) ...
Selecting previously unselected package libxaw7:amd64.
Preparing to unpack .../112-libxaw7_2%3a1.0.13-1+b2_amd64.deb ...
Unpacking libxaw7:amd64 (2:1.0.13-1+b2) ...
Selecting previously unselected package libxcb-shape0:amd64.
Preparing to unpack .../113-libxcb-shape0_1.12-1_amd64.deb ...
Unpacking libxcb-shape0:amd64 (1.12-1) ...
Selecting previously unselected package libxft2:amd64.
Preparing to unpack .../114-libxft2_2.3.2-1+b2_amd64.deb ...
Unpacking libxft2:amd64 (2.3.2-1+b2) ...
Selecting previously unselected package libxmuu1:amd64.
Preparing to unpack .../115-libxmuu1_2%3a1.1.2-2_amd64.deb ...
Unpacking libxmuu1:amd64 (2:1.1.2-2) ...
Selecting previously unselected package libxv1:amd64.
Preparing to unpack .../116-libxv1_2%3a1.0.11-1_amd64.deb ...
Unpacking libxv1:amd64 (2:1.0.11-1) ...
Selecting previously unselected package libxxf86dga1:amd64.
Preparing to unpack .../117-libxxf86dga1_2%3a1.1.4-1+b3_amd64.deb ...
Unpacking libxxf86dga1:amd64 (2:1.1.4-1+b3) ...
Selecting previously unselected package x11-utils.
Preparing to unpack .../118-x11-utils_7.7+3+b1_amd64.deb ...
Unpacking x11-utils (7.7+3+b1) ...
Selecting previously unselected package libatk-wrapper-java.
Preparing to unpack .../119-libatk-wrapper-java_0.33.3-13_all.deb ...
Unpacking libatk-wrapper-java (0.33.3-13) ...
Selecting previously unselected package libatk-wrapper-java-jni:amd64.
Preparing to unpack .../120-libatk-wrapper-java-jni_0.33.3-13_amd64.deb ...
Unpacking libatk-wrapper-java-jni:amd64 (0.33.3-13) ...
Selecting previously unselected package libasound2-data.
Preparing to unpack .../121-libasound2-data_1.1.3-5_all.deb ...
Unpacking libasound2-data (1.1.3-5) ...
Selecting previously unselected package libasound2:amd64.
Preparing to unpack .../122-libasound2_1.1.3-5_amd64.deb ...
Unpacking libasound2:amd64 (1.1.3-5) ...
Selecting previously unselected package libgif7:amd64.
Preparing to unpack .../123-libgif7_5.1.4-0.4_amd64.deb ...
Unpacking libgif7:amd64 (5.1.4-0.4) ...
Selecting previously unselected package libasyncns0:amd64.
Preparing to unpack .../124-libasyncns0_0.8-6_amd64.deb ...
Unpacking libasyncns0:amd64 (0.8-6) ...
Selecting previously unselected package libflac8:amd64.
Preparing to unpack .../125-libflac8_1.3.2-1_amd64.deb ...
Unpacking libflac8:amd64 (1.3.2-1) ...
Selecting previously unselected package libvorbis0a:amd64.
Preparing to unpack .../126-libvorbis0a_1.3.5-4_amd64.deb ...
Unpacking libvorbis0a:amd64 (1.3.5-4) ...
Selecting previously unselected package libvorbisenc2:amd64.
Preparing to unpack .../127-libvorbisenc2_1.3.5-4_amd64.deb ...
Unpacking libvorbisenc2:amd64 (1.3.5-4) ...
Selecting previously unselected package libsndfile1:amd64.
Preparing to unpack .../128-libsndfile1_1.0.28-2_amd64.deb ...
Unpacking libsndfile1:amd64 (1.0.28-2) ...
Selecting previously unselected package libpulse0:amd64.
Preparing to unpack .../129-libpulse0_10.0-2_amd64.deb ...
Unpacking libpulse0:amd64 (10.0-2) ...
Selecting previously unselected package openjdk-8-jre:amd64.
Preparing to unpack .../130-openjdk-8-jre_8u131-b11-2_amd64.deb ...
Unpacking openjdk-8-jre:amd64 (8u131-b11-2) ...
Selecting previously unselected package default-jre.
Preparing to unpack .../131-default-jre_2%3a1.8-59_amd64.deb ...
Unpacking default-jre (2:1.8-59) ...
Selecting previously unselected package openjdk-8-jdk-headless:amd64.
Preparing to unpack .../132-openjdk-8-jdk-headless_8u131-b11-2_amd64.deb ...
Unpacking openjdk-8-jdk-headless:amd64 (8u131-b11-2) ...
Selecting previously unselected package default-jdk-headless.
Preparing to unpack .../133-default-jdk-headless_2%3a1.8-59_amd64.deb ...
Unpacking default-jdk-headless (2:1.8-59) ...
Selecting previously unselected package openjdk-8-jdk:amd64.
Preparing to unpack .../134-openjdk-8-jdk_8u131-b11-2_amd64.deb ...
Unpacking openjdk-8-jdk:amd64 (8u131-b11-2) ...
Selecting previously unselected package default-jdk.
Preparing to unpack .../135-default-jdk_2%3a1.8-59_amd64.deb ...
Unpacking default-jdk (2:1.8-59) ...
Selecting previously unselected package libfile-which-perl.
Preparing to unpack .../136-libfile-which-perl_1.21-1_all.deb ...
Unpacking libfile-which-perl (1.21-1) ...
Selecting previously unselected package libfile-homedir-perl.
Preparing to unpack .../137-libfile-homedir-perl_1.00-1_all.deb ...
Unpacking libfile-homedir-perl (1.00-1) ...
Selecting previously unselected package devscripts.
Preparing to unpack .../138-devscripts_2.17.6_amd64.deb ...
Unpacking devscripts (2.17.6) ...
Selecting previously unselected package jaligner.
Preparing to unpack .../139-jaligner_1.0+dfsg-4_all.deb ...
Unpacking jaligner (1.0+dfsg-4) ...
Selecting previously unselected package javahelper.
Preparing to unpack .../140-javahelper_0.61_all.deb ...
Unpacking javahelper (0.61) ...
Selecting previously unselected package libjellyfish-2.0-2.
Preparing to unpack .../141-libjellyfish-2.0-2_2.2.6-1+b2_amd64.deb ...
Unpacking libjellyfish-2.0-2 (2.2.6-1+b2) ...
Selecting previously unselected package jellyfish.
Preparing to unpack .../142-jellyfish_2.2.6-1+b2_amd64.deb ...
Unpacking jellyfish (2.2.6-1+b2) ...
Selecting previously unselected package libconcurrent-java.
Preparing to unpack .../143-libconcurrent-java_1.3.4-4_all.deb ...
Unpacking libconcurrent-java (1.3.4-4) ...
Selecting previously unselected package libcolt-free-java.
Preparing to unpack .../144-libcolt-free-java_1.2.0+dfsg-4_all.deb ...
Unpacking libcolt-free-java (1.2.0+dfsg-4) ...
Selecting previously unselected package libcommons-collections4-java.
Preparing to unpack .../145-libcommons-collections4-java_4.1-1_all.deb ...
Unpacking libcommons-collections4-java (4.1-1) ...
Selecting previously unselected package libnghttp2-14:amd64.
Preparing to unpack .../146-libnghttp2-14_1.24.0-1_amd64.deb ...
Unpacking libnghttp2-14:amd64 (1.24.0-1) ...
Selecting previously unselected package libpsl5:amd64.
Preparing to unpack .../147-libpsl5_0.17.0-4+b1_amd64.deb ...
Unpacking libpsl5:amd64 (0.17.0-4+b1) ...
Selecting previously unselected package librtmp1:amd64.
Preparing to unpack .../148-librtmp1_2.4+20151223.gitfa8646d.1-1+b1_amd64.deb ...
Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-1+b1) ...
Selecting previously unselected package libssh2-1:amd64.
Preparing to unpack .../149-libssh2-1_1.8.0-1_amd64.deb ...
Unpacking libssh2-1:amd64 (1.8.0-1) ...
Selecting previously unselected package libcurl3-gnutls:amd64.
Preparing to unpack .../150-libcurl3-gnutls_7.52.1-5_amd64.deb ...
Unpacking libcurl3-gnutls:amd64 (7.52.1-5) ...
Selecting previously unselected package libgetopt-java.
Preparing to unpack .../151-libgetopt-java_1.0.14+dfsg-3_all.deb ...
Unpacking libgetopt-java (1.0.14+dfsg-3) ...
Selecting previously unselected package libhts2:amd64.
Preparing to unpack .../152-libhts2_1.4.1-2_amd64.deb ...
Unpacking libhts2:amd64 (1.4.1-2) ...
Selecting previously unselected package libhts-dev:amd64.
Preparing to unpack .../153-libhts-dev_1.4.1-2_amd64.deb ...
Unpacking libhts-dev:amd64 (1.4.1-2) ...
Selecting previously unselected package libjs-jquery.
Preparing to unpack .../154-libjs-jquery_3.1.1-2_all.deb ...
Unpacking libjs-jquery (3.1.1-2) ...
Selecting previously unselected package libvecmath-java.
Preparing to unpack .../155-libvecmath-java_1.5.2-6_all.deb ...
Unpacking libvecmath-java (1.5.2-6) ...
Selecting previously unselected package libjung-free-java.
Preparing to unpack .../156-libjung-free-java_2.0.1+dfsg-1_all.deb ...
Unpacking libjung-free-java (2.0.1+dfsg-1) ...
Selecting previously unselected package parafly.
Preparing to unpack .../157-parafly_0.0.2013.01.21-3+b1_amd64.deb ...
Unpacking parafly (0.0.2013.01.21-3+b1) ...
Selecting previously unselected package sbuild-build-depends-trinityrnaseq-dummy.
Preparing to unpack .../158-sbuild-build-depends-trinityrnaseq-dummy_0.invalid.0_amd64.deb ...
Unpacking sbuild-build-depends-trinityrnaseq-dummy (0.invalid.0) ...
Setting up libjs-jquery (3.1.1-2) ...
Setting up readline-common (7.0-3) ...
Setting up libjson-glib-1.0-common (1.2.8-1) ...
Setting up libgtk2.0-common (2.24.31-2) ...
Setting up libasyncns0:amd64 (0.8-6) ...
Setting up glib-networking-common (2.50.0-1) ...
Setting up libjpeg62-turbo:amd64 (1:1.5.1-2) ...
Setting up libarchive-zip-perl (1.59-1) ...
Setting up libnghttp2-14:amd64 (1.24.0-1) ...
Setting up mime-support (3.60) ...
Setting up libfile-which-perl (1.21-1) ...
Setting up libpng16-16:amd64 (1.6.29-3) ...
Setting up libtimedate-perl (2.3000-2) ...
Setting up liblcms2-2:amd64 (2.8-4) ...
Setting up libjbig0:amd64 (2.1-3.1+b2) ...
Setting up libpcsclite1:amd64 (1.8.22-1) ...
Setting up libsigsegv2:amd64 (2.11-1) ...
Setting up libldap-common (2.4.44+dfsg-7) ...
Setting up fonts-dejavu-core (2.37-1) ...
Setting up libreadline7:amd64 (7.0-3) ...
Setting up libpsl5:amd64 (0.17.0-4+b1) ...
Setting up libfile-homedir-perl (1.00-1) ...
Setting up groff-base (1.22.3-9) ...
Setting up libglib2.0-0:amd64 (2.52.3-1) ...
Setting up libasound2-data (1.1.3-5) ...
Setting up libxshmfence1:amd64 (1.2-1+b2) ...
Setting up libcap2:amd64 (1:2.25-1) ...
Setting up libwayland-client0:amd64 (1.12.0-1) ...
Setting up xkb-data (2.19-1) ...
Setting up libsasl2-modules-db:amd64 (2.1.27~101-g0780600+dfsg-3) ...
Setting up libproxy1v5:amd64 (0.4.14-3) ...
Setting up java-common (0.59) ...
Setting up libsasl2-2:amd64 (2.1.27~101-g0780600+dfsg-3) ...
Setting up parafly (0.0.2013.01.21-3+b1) ...
Setting up dctrl-tools (2.24-2+b1) ...
Setting up libgdk-pixbuf2.0-common (2.36.5-2) ...
Setting up libcommons-collections4-java (4.1-1) ...
Setting up glib-networking-services (2.50.0-1+b1) ...
Setting up libdatrie1:amd64 (0.2.10-4+b1) ...
Setting up libtiff5:amd64 (4.0.8-3) ...
Setting up gettext-base (0.19.8.1-2+b1) ...
Setting up libgif7:amd64 (5.1.4-0.4) ...
Setting up libpipeline1:amd64 (1.4.1-2) ...
Setting up libglapi-mesa:amd64 (17.1.4-1) ...
Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-1+b1) ...
Setting up m4 (1.4.18-1) ...
Setting up libicu57:amd64 (57.1-6) ...
Setting up libnspr4:amd64 (2:4.15-1) ...
Setting up ucf (3.0036) ...
Setting up libxml2:amd64 (2.9.4+dfsg1-3) ...
Setting up libfreetype6:amd64 (2.8-0.2) ...
Setting up libmagic-mgc (1:5.30-1) ...
Setting up libasound2:amd64 (1.1.3-5) ...
Setting up libdrm2:amd64 (2.4.81-2) ...
Setting up libmagic1:amd64 (1:5.30-1) ...
Setting up libjson-glib-1.0-0:amd64 (1.2.8-1) ...
Setting up lsb-base (9.20161125) ...
Setting up libgraphite2-3:amd64 (1.3.10-2) ...
Setting up libcroco3:amd64 (0.6.12-1) ...
Setting up libogg0:amd64 (1.3.2-1) ...
Setting up libatk1.0-data (2.22.0-1) ...
Setting up libx11-xcb1:amd64 (2:1.6.4-3) ...
Setting up libpixman-1-0:amd64 (0.34.0-1) ...
Setting up libssh2-1:amd64 (1.8.0-1) ...
Setting up libvecmath-java (1.5.2-6) ...
Processing triggers for libc-bin (2.24-12) ...
Setting up libepoxy0:amd64 (1.3.1-3) ...
Setting up autotools-dev (20161112.1) ...
Setting up libldap-2.4-2:amd64 (2.4.44+dfsg-7) ...
Setting up libatk1.0-0:amd64 (2.22.0-1) ...
Setting up openssl (1.1.0f-3) ...
Setting up libsqlite3-0:amd64 (3.16.2-5) ...
Setting up libfontenc1:amd64 (1:1.1.3-1+b2) ...
Setting up libdconf1:amd64 (0.26.0-2+b1) ...
Setting up shared-mime-info (1.8-1) ...
Setting up libxkbcommon0:amd64 (0.7.1-1) ...
Setting up libcolord2:amd64 (1.3.3-2) ...
Setting up libthai-data (0.1.26-1) ...
Setting up libxdmcp6:amd64 (1:1.1.2-3) ...
Setting up libkeyutils1:amd64 (1.5.9-9) ...
Setting up bsdmainutils (9.0.12+nmu1) ...
update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode
update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode
Setting up libvorbis0a:amd64 (1.3.5-4) ...
Setting up x11-common (1:7.7+19) ...
update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
invoke-rc.d: could not determine current runlevel
All runlevel operations denied by policy
invoke-rc.d: policy-rc.d denied execution of start.
Setting up ca-certificates (20161130+nmu1) ...
Updating certificates in /etc/ssl/certs...
166 added, 0 removed; done.
Setting up hicolor-icon-theme (0.15-1) ...
Setting up libgetopt-java (1.0.14+dfsg-3) ...
Setting up libwayland-cursor0:amd64 (1.12.0-1) ...
Setting up libx11-data (2:1.6.4-3) ...
Setting up libxau6:amd64 (1:1.0.8-1) ...
Setting up autopoint (0.19.8.1-2) ...
Setting up libjellyfish-2.0-2 (2.2.6-1+b2) ...
Setting up libmpdec2:amd64 (2.4.2-1) ...
Setting up libdbus-1-3:amd64 (1.10.20-1) ...
Setting up libwrap0:amd64 (7.6.q-26) ...
Setting up libavahi-common-data:amd64 (0.6.32-2) ...
Setting up libwayland-server0:amd64 (1.12.0-1) ...
Setting up libfile-stripnondeterminism-perl (0.035-2) ...
Setting up fontconfig-config (2.12.3-0.1) ...
Setting up dconf-service (0.26.0-2+b1) ...
Setting up gettext (0.19.8.1-2+b1) ...
Setting up libpython3.5-stdlib:amd64 (3.5.3-3) ...
Setting up libgbm1:amd64 (17.1.4-1) ...
Setting up libflac8:amd64 (1.3.2-1) ...
Setting up libnss3:amd64 (2:3.31-1) ...
Setting up libharfbuzz0b:amd64 (1.4.2-1) ...
Setting up autoconf (2.69-10) ...
Setting up libthai0:amd64 (0.1.26-1) ...
Setting up file (1:5.30-1) ...
Setting up libkrb5support0:amd64 (1.15-1) ...
Setting up intltool-debian (0.35.0+20060710.4) ...
Setting up jellyfish (2.2.6-1+b2) ...
Setting up automake (1:1.15.1-2) ...
update-alternatives: using /usr/bin/automake-1.15 to provide /usr/bin/automake (automake) in auto mode
Setting up libice6:amd64 (2:1.0.9-2) ...
Setting up man-db (2.7.6.1-2) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libavahi-common3:amd64 (0.6.32-2) ...
Setting up libvorbisenc2:amd64 (1.3.5-4) ...
Setting up dconf-gsettings-backend:amd64 (0.26.0-2+b1) ...
Setting up libxcb1:amd64 (1.12-1) ...
Setting up automake1.11 (1:1.11.6-4) ...
Setting up libtool (2.4.6-2) ...
Setting up python3.5 (3.5.3-3) ...
Setting up libpython3-stdlib:amd64 (3.5.3-3) ...
Setting up libxcb-present0:amd64 (1.12-1) ...
Setting up libfontconfig1:amd64 (2.12.3-0.1) ...
Setting up libxcb-dri2-0:amd64 (1.12-1) ...
Setting up libsm6:amd64 (2:1.2.2-1+b3) ...
Setting up libxcb-dri3-0:amd64 (1.12-1) ...
Setting up libk5crypto3:amd64 (1.15-1) ...
Setting up libxcb-glx0:amd64 (1.12-1) ...
Setting up libxcb-xfixes0:amd64 (1.12-1) ...
Setting up libxcb-render0:amd64 (1.12-1) ...
Setting up po-debconf (1.0.20) ...
Setting up gsettings-desktop-schemas (3.22.0-1) ...
Setting up libgtk-3-common (3.22.16-1) ...
Setting up libx11-6:amd64 (2:1.6.4-3) ...
Setting up libxmuu1:amd64 (2:1.1.2-2) ...
Setting up libxcb-sync1:amd64 (1.12-1) ...
Setting up libsndfile1:amd64 (1.0.28-2) ...
Setting up glib-networking:amd64 (2.50.0-1+b1) ...
Setting up libxcomposite1:amd64 (1:0.4.4-2) ...
Setting up libxcb-shm0:amd64 (1.12-1) ...
Setting up libxpm4:amd64 (1:3.5.12-1) ...
Setting up libxt6:amd64 (1:1.1.5-1) ...
Setting up libxcb-shape0:amd64 (1.12-1) ...
Setting up libxrender1:amd64 (1:0.9.10-1) ...
Setting up libavahi-client3:amd64 (0.6.32-2) ...
Setting up libkrb5-3:amd64 (1.15-1) ...
Setting up libxft2:amd64 (2.3.2-1+b2) ...
Setting up fontconfig (2.12.3-0.1) ...
Regenerating fonts cache... done.
Setting up libegl1-mesa:amd64 (17.1.4-1) ...
Setting up libxext6:amd64 (2:1.3.3-1+b2) ...
Setting up libxfixes3:amd64 (1:5.0.3-1) ...
Setting up libatspi2.0-0:amd64 (2.24.1-1) ...
Setting up libgdk-pixbuf2.0-0:amd64 (2.36.5-2) ...
Setting up libxmu6:amd64 (2:1.1.2-2) ...
Setting up libgssapi-krb5-2:amd64 (1.15-1) ...
Setting up gtk-update-icon-cache (3.22.16-1) ...
Setting up libxcursor1:amd64 (1:1.1.14-1+b4) ...
Setting up libxxf86dga1:amd64 (2:1.1.4-1+b3) ...
Setting up libpango-1.0-0:amd64 (1.40.6-1) ...
Setting up libwayland-egl1-mesa:amd64 (17.1.4-1) ...
Setting up libatk-bridge2.0-0:amd64 (2.24.1-1) ...
Setting up libxv1:amd64 (2:1.0.11-1) ...
Setting up libxxf86vm1:amd64 (1:1.1.4-1+b2) ...
Setting up libxrandr2:amd64 (2:1.5.1-1) ...
Setting up libcups2:amd64 (2.2.4-1) ...
Setting up libxi6:amd64 (2:1.7.9-1) ...
Setting up libxaw7:amd64 (2:1.0.13-1+b2) ...
Setting up libcairo2:amd64 (1.14.10-1) ...
Setting up libxinerama1:amd64 (2:1.1.3-1+b3) ...
Setting up libxdamage1:amd64 (1:1.1.4-2+b3) ...
Setting up libcurl3-gnutls:amd64 (7.52.1-5) ...
Setting up libcairo-gobject2:amd64 (1.14.10-1) ...
Setting up libsoup2.4-1:amd64 (2.56.0-2) ...
Setting up libsoup-gnome2.4-1:amd64 (2.56.0-2) ...
Setting up libxtst6:amd64 (2:1.2.3-1) ...
Setting up libpangoft2-1.0-0:amd64 (1.40.6-1) ...
Setting up libgl1-mesa-glx:amd64 (17.1.4-1) ...
Setting up librest-0.7-0:amd64 (0.8.0-2) ...
Setting up libhts2:amd64 (1.4.1-2) ...
Setting up libhts-dev:amd64 (1.4.1-2) ...
Setting up x11-utils (7.7+3+b1) ...
Setting up libpangocairo-1.0-0:amd64 (1.40.6-1) ...
Setting up libpulse0:amd64 (10.0-2) ...
Setting up libatk-wrapper-java (0.33.3-13) ...
Setting up librsvg2-2:amd64 (2.40.16-1+b1) ...
Setting up librsvg2-common:amd64 (2.40.16-1+b1) ...
Setting up adwaita-icon-theme (3.22.0-1) ...
update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode
Setting up libgtk2.0-0:amd64 (2.24.31-2) ...
Setting up gnome-icon-theme (3.12.0-2) ...
update-alternatives: using /usr/share/icons/gnome/scalable/places/debian-swirl.svg to provide /usr/share/icons/gnome/scalable/places/start-here.svg (start-here.svg) in auto mode
Setting up libgtk-3-0:amd64 (3.22.16-1) ...
Setting up libatk-wrapper-java-jni:amd64 (0.33.3-13) ...
Setting up dh-python (2.20170125) ...
Setting up openjdk-8-jre-headless:amd64 (8u131-b11-2) ...
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/rmid to provide /usr/bin/rmid (rmid) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/java to provide /usr/bin/java (java) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/jjs to provide /usr/bin/jjs (jjs) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/pack200 to provide /usr/bin/pack200 (pack200) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/unpack200 to provide /usr/bin/unpack200 (unpack200) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/orbd to provide /usr/bin/orbd (orbd) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/servertool to provide /usr/bin/servertool (servertool) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/tnameserv to provide /usr/bin/tnameserv (tnameserv) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode
Setting up libconcurrent-java (1.3.4-4) ...
Setting up ca-certificates-java (20170531+nmu1) ...
Adding debian:GlobalSign_Root_CA.pem
Adding debian:Camerfirma_Chambers_of_Commerce_Root.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/NetLock_Arany_=Class_Gold=_F?tan?s?tv?ny.pem. Message:
  /etc/ssl/certs/NetLock_Arany_=Class_Gold=_F?tan?s?tv?ny.pem (No such file or directory)
Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/AC_Ra?z_Certic?mara_S.A..pem. Message:
  /etc/ssl/certs/AC_Ra?z_Certic?mara_S.A..pem (No such file or directory)
Warning: there was a problem reading the certificate file /etc/ssl/certs/EBG_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?.pem. Message:
  /etc/ssl/certs/EBG_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?.pem (No such file or directory)
Adding debian:Global_Chambersign_Root_-_2008.pem
Adding debian:Security_Communication_Root_CA.pem
Adding debian:Visa_eCommerce_Root.pem
Adding debian:GeoTrust_Primary_Certification_Authority.pem
Adding debian:RSA_Security_2048_v3.pem
Adding debian:Verisign_Class_3_Public_Primary_Certification_Authority_-_G3.pem
Adding debian:Atos_TrustedRoot_2011.pem
Adding debian:Equifax_Secure_Global_eBusiness_CA.pem
Adding debian:GeoTrust_Primary_Certification_Authority_-_G3.pem
Adding debian:Root_CA_Generalitat_Valenciana.pem
Adding debian:Cybertrust_Global_Root.pem
Adding debian:Certum_Root_CA.pem
Adding debian:IdenTrust_Commercial_Root_CA_1.pem
Adding debian:DigiCert_Assured_ID_Root_G3.pem
Adding debian:AddTrust_External_Root.pem
Adding debian:Staat_der_Nederlanden_EV_Root_CA.pem
Adding debian:S-TRUST_Authentication_and_Encryption_Root_CA_2005_PN.pem
Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem
Adding debian:Chambers_of_Commerce_Root_-_2008.pem
Adding debian:SecureTrust_CA.pem
Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem
Adding debian:Camerfirma_Global_Chambersign_Root.pem
Adding debian:CA_Disig_Root_R2.pem
Adding debian:Entrust_Root_Certification_Authority.pem
Adding debian:SwissSign_Silver_CA_-_G2.pem
Adding debian:CA_Disig_Root_R1.pem
Adding debian:AffirmTrust_Premium_ECC.pem
Adding debian:Certinomis_-_Root_CA.pem
Adding debian:Network_Solutions_Certificate_Authority.pem
Adding debian:T-TeleSec_GlobalRoot_Class_3.pem
Adding debian:VeriSign_Class_3_Public_Primary_Certification_Authority_-_G5.pem
Adding debian:EE_Certification_Centre_Root_CA.pem
Adding debian:ePKI_Root_Certification_Authority.pem
Adding debian:Certum_Trusted_Network_CA.pem
Adding debian:SZAFIR_ROOT_CA2.pem
Adding debian:GlobalSign_Root_CA_-_R2.pem
Adding debian:VeriSign_Class_3_Public_Primary_Certification_Authority_-_G4.pem
Adding debian:OpenTrust_Root_CA_G3.pem
Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem
Adding debian:ApplicationCA_-_Japanese_Government.pem
Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem
Adding debian:DigiCert_Global_Root_CA.pem
Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem
Adding debian:E-Tugra_Certification_Authority.pem
Adding debian:Microsec_e-Szigno_Root_CA.pem
Adding debian:Swisscom_Root_CA_1.pem
Adding debian:Hongkong_Post_Root_CA_1.pem
Adding debian:AddTrust_Public_Services_Root.pem
Adding debian:Secure_Global_CA.pem
Adding debian:TC_TrustCenter_Class_3_CA_II.pem
Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem
Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem
Adding debian:Comodo_Trusted_Services_root.pem
Adding debian:IGC_A.pem
Adding debian:AffirmTrust_Premium.pem
Adding debian:AddTrust_Qualified_Certificates_Root.pem
Adding debian:QuoVadis_Root_CA.pem
Adding debian:Buypass_Class_3_Root_CA.pem
Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2011.pem
Adding debian:UTN_USERFirst_Email_Root_CA.pem
Adding debian:CFCA_EV_ROOT.pem
Adding debian:CNNIC_ROOT.pem
Adding debian:QuoVadis_Root_CA_1_G3.pem
Adding debian:DST_Root_CA_X3.pem
Adding debian:USERTrust_ECC_Certification_Authority.pem
Adding debian:COMODO_ECC_Certification_Authority.pem
Adding debian:TURKTRUST_Certificate_Services_Provider_Root_2007.pem
Adding debian:Equifax_Secure_CA.pem
Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem
Adding debian:DigiCert_Assured_ID_Root_G2.pem
Adding debian:certSIGN_ROOT_CA.pem
Adding debian:T-TeleSec_GlobalRoot_Class_2.pem
Adding debian:SecureSign_RootCA11.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/Certinomis_-_Autorit?_Racine.pem. Message:
  /etc/ssl/certs/Certinomis_-_Autorit?_Racine.pem (No such file or directory)
Adding debian:XRamp_Global_CA_Root.pem
Adding debian:ACCVRAIZ1.pem
Adding debian:Verisign_Class_2_Public_Primary_Certification_Authority_-_G3.pem
Adding debian:Comodo_AAA_Services_root.pem
Adding debian:Buypass_Class_2_CA_1.pem
Adding debian:Baltimore_CyberTrust_Root.pem
Adding debian:Certum_Trusted_Network_CA_2.pem
Adding debian:thawte_Primary_Root_CA_-_G3.pem
Adding debian:GeoTrust_Global_CA.pem
Adding debian:Buypass_Class_2_Root_CA.pem
Adding debian:DigiCert_Global_Root_G2.pem
Adding debian:thawte_Primary_Root_CA.pem
Adding debian:OpenTrust_Root_CA_G1.pem
Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem
Adding debian:Sonera_Class_2_Root_CA.pem
Adding debian:DigiCert_Trusted_Root_G4.pem
Adding debian:Microsec_e-Szigno_Root_CA_2009.pem
Adding debian:Verisign_Class_1_Public_Primary_Certification_Authority_-_G3.pem
Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem
Adding debian:Actalis_Authentication_Root_CA.pem
Adding debian:GeoTrust_Universal_CA.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/T?B?TAK_UEKAE_K?k_Sertifika_Hizmet_Sa?lay?c?s?_-_S?r?m_3.pem. Message:
  /etc/ssl/certs/T?B?TAK_UEKAE_K?k_Sertifika_Hizmet_Sa?lay?c?s?_-_S?r?m_3.pem (No such file or directory)
Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem
Adding debian:AffirmTrust_Commercial.pem
Adding debian:Security_Communication_EV_RootCA1.pem
Adding debian:Certplus_Root_CA_G2.pem
Adding debian:GeoTrust_Primary_Certification_Authority_-_G2.pem
Adding debian:WellsSecure_Public_Root_Certificate_Authority.pem
Adding debian:EC-ACC.pem
Adding debian:ISRG_Root_X1.pem
Adding debian:SwissSign_Gold_CA_-_G2.pem
Adding debian:DigiCert_Global_Root_G3.pem
Adding debian:SwissSign_Platinum_CA_-_G2.pem
Adding debian:Swisscom_Root_CA_2.pem
Adding debian:Go_Daddy_Class_2_CA.pem
Adding debian:Certigna.pem
Adding debian:TWCA_Global_Root_CA.pem
Adding debian:TeliaSonera_Root_CA_v1.pem
Adding debian:USERTrust_RSA_Certification_Authority.pem
Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem
Adding debian:UTN_USERFirst_Hardware_Root_CA.pem
Adding debian:Entrust_Root_Certification_Authority_-_G2.pem
Adding debian:VeriSign_Universal_Root_Certification_Authority.pem
Adding debian:thawte_Primary_Root_CA_-_G2.pem
Adding debian:QuoVadis_Root_CA_2_G3.pem
Adding debian:Swisscom_Root_EV_CA_2.pem
Adding debian:COMODO_RSA_Certification_Authority.pem
Adding debian:Verisign_Class_1_Public_Primary_Certification_Authority.pem
Adding debian:GeoTrust_Universal_CA_2.pem
Adding debian:Verisign_Class_2_Public_Primary_Certification_Authority_-_G2.pem
Adding debian:Staat_der_Nederlanden_Root_CA_-_G3.pem
Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem
Adding debian:Deutsche_Telekom_Root_CA_2.pem
Adding debian:Security_Communication_RootCA2.pem
Adding debian:Certplus_Root_CA_G1.pem
Adding debian:QuoVadis_Root_CA_3.pem
Adding debian:QuoVadis_Root_CA_3_G3.pem
Adding debian:ACEDICOM_Root.pem
Adding debian:TWCA_Root_Certification_Authority.pem
Adding debian:PSCProcert.pem
Adding debian:Juur-SK.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/T?RKTRUST_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?_H6.pem. Message:
  /etc/ssl/certs/T?RKTRUST_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?_H6.pem (No such file or directory)
Adding debian:OISTE_WISeKey_Global_Root_GA_CA.pem
Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem
Adding debian:Verisign_Class_3_Public_Primary_Certification_Authority.pem
Adding debian:Certplus_Class_2_Primary_CA.pem
Warning: there was a problem reading the certificate file /etc/ssl/certs/T?RKTRUST_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?_H5.pem. Message:
  /etc/ssl/certs/T?RKTRUST_Elektronik_Sertifika_Hizmet_Sa?lay?c?s?_H5.pem (No such file or directory)
Adding debian:QuoVadis_Root_CA_2.pem
Adding debian:AffirmTrust_Networking.pem
Adding debian:Izenpe.com.pem
Adding debian:AddTrust_Low-Value_Services_Root.pem
Adding debian:Staat_der_Nederlanden_Root_CA_-_G2.pem
Adding debian:DigiCert_Assured_ID_Root_CA.pem
Adding debian:Equifax_Secure_eBusiness_CA_1.pem
Adding debian:Starfield_Class_2_CA.pem
Adding debian:Taiwan_GRCA.pem
Adding debian:GeoTrust_Global_CA_2.pem
Adding debian:DST_ACES_CA_X6.pem
Adding debian:OpenTrust_Root_CA_G2.pem
Adding debian:Trustis_FPS_Root_CA.pem
Adding debian:GlobalSign_Root_CA_-_R3.pem
Adding debian:Comodo_Secure_Services_root.pem
Adding debian:COMODO_Certification_Authority.pem
Adding debian:ComSign_CA.pem
Adding debian:S-TRUST_Universal_Root_CA.pem
Adding debian:China_Internet_Network_Information_Center_EV_Certificates_Root.pem
done.
Setting up dh-autoreconf (14) ...
Setting up python3 (3.5.3-3) ...
Setting up openjdk-8-jdk-headless:amd64 (8u131-b11-2) ...
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/idlj to provide /usr/bin/idlj (idlj) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jdeps to provide /usr/bin/jdeps (jdeps) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/wsimport to provide /usr/bin/wsimport (wsimport) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/rmic to provide /usr/bin/rmic (rmic) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jinfo to provide /usr/bin/jinfo (jinfo) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jsadebugd to provide /usr/bin/jsadebugd (jsadebugd) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/native2ascii to provide /usr/bin/native2ascii (native2ascii) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jstat to provide /usr/bin/jstat (jstat) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/javac to provide /usr/bin/javac (javac) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/javah to provide /usr/bin/javah (javah) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jstack to provide /usr/bin/jstack (jstack) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jrunscript to provide /usr/bin/jrunscript (jrunscript) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/javadoc to provide /usr/bin/javadoc (javadoc) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jhat to provide /usr/bin/jhat (jhat) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/javap to provide /usr/bin/javap (javap) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jar to provide /usr/bin/jar (jar) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/xjc to provide /usr/bin/xjc (xjc) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/schemagen to provide /usr/bin/schemagen (schemagen) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jps to provide /usr/bin/jps (jps) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/extcheck to provide /usr/bin/extcheck (extcheck) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jmap to provide /usr/bin/jmap (jmap) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jstatd to provide /usr/bin/jstatd (jstatd) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jdb to provide /usr/bin/jdb (jdb) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/serialver to provide /usr/bin/serialver (serialver) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/wsgen to provide /usr/bin/wsgen (wsgen) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jcmd to provide /usr/bin/jcmd (jcmd) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jarsigner to provide /usr/bin/jarsigner (jarsigner) in auto mode
Setting up devscripts (2.17.6) ...
Setting up dh-strip-nondeterminism (0.035-2) ...
Setting up openjdk-8-jre:amd64 (8u131-b11-2) ...
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/jre/bin/policytool to provide /usr/bin/policytool (policytool) in auto mode
Setting up libcolt-free-java (1.2.0+dfsg-4) ...
Setting up default-jre-headless (2:1.8-59) ...
Setting up default-jdk-headless (2:1.8-59) ...
Setting up libjung-free-java (2.0.1+dfsg-1) ...
Setting up debhelper (10.6.2) ...
Setting up openjdk-8-jdk:amd64 (8u131-b11-2) ...
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/appletviewer to provide /usr/bin/appletviewer (appletviewer) in auto mode
update-alternatives: using /usr/lib/jvm/java-8-openjdk-amd64/bin/jconsole to provide /usr/bin/jconsole (jconsole) in auto mode
Setting up default-jre (2:1.8-59) ...
Setting up jaligner (1.0+dfsg-4) ...
Setting up javahelper (0.61) ...
Setting up default-jdk (2:1.8-59) ...
Setting up sbuild-build-depends-trinityrnaseq-dummy (0.invalid.0) ...
Processing triggers for libc-bin (2.24-12) ...
Processing triggers for ca-certificates (20161130+nmu1) ...
Updating certificates in /etc/ssl/certs...
0 added, 0 removed; done.
Running hooks in /etc/ca-certificates/update.d...

done.
done.
Processing triggers for libgdk-pixbuf2.0-0:amd64 (2.36.5-2) ...

+------------------------------------------------------------------------------+
| Build environment                                                            |
+------------------------------------------------------------------------------+

Kernel: Linux 4.9.0-2-amd64 amd64 (x86_64)
Toolchain package versions: binutils_2.28-6 dpkg-dev_1.18.24 g++-6_6.4.0-1 gcc-6_6.4.0-1 libc6-dev_2.24-12 libstdc++-6-dev_6.4.0-1 libstdc++6_7.1.0-9 linux-libc-dev_4.11.6-1
Package versions: adduser_3.115 adwaita-icon-theme_3.22.0-1 apt_1.5~beta1 autoconf_2.69-10 automake_1:1.15.1-2 automake1.11_1:1.11.6-4 autopoint_0.19.8.1-2 autotools-dev_20161112.1 base-files_10 base-passwd_3.5.43 bash_4.4-5 binutils_2.28-6 bsdmainutils_9.0.12+nmu1 bsdutils_1:2.29.2-1 build-essential_12.3 bzip2_1.0.6-8.1 ca-certificates_20161130+nmu1 ca-certificates-java_20170531+nmu1 clang-3.9_1:3.9.1-10 coreutils_8.26-3 cpp_4:6.3.0-4d1 cpp-6_6.4.0-1 dash_0.5.8-2.4 dconf-gsettings-backend_0.26.0-2+b1 dconf-service_0.26.0-2+b1 dctrl-tools_2.24-2+b1 debconf_1.5.62 debfoster_2.7-2.1+b1 debhelper_10.6.2 debian-archive-keyring_2017.5 debianutils_4.8.1.1 default-jdk_2:1.8-59 default-jdk-headless_2:1.8-59 default-jre_2:1.8-59 default-jre-headless_2:1.8-59 devscripts_2.17.6 dh-autoreconf_14 dh-python_2.20170125 dh-strip-nondeterminism_0.035-2 diffutils_1:3.5-3 dpkg_1.18.24 dpkg-dev_1.18.24 e2fslibs_1.43.4-2 e2fsprogs_1.43.4-2 eatmydata_105-5 fakeroot_1.21-3.1 file_1:5.30-1 findutils_4.6.0+git+20170606-2 fontconfig_2.12.3-0.1 fontconfig-config_2.12.3-0.1 fonts-dejavu-core_2.37-1 g++_4:6.3.0-4d1 g++-6_6.4.0-1 gcc_4:6.3.0-4d1 gcc-6_6.4.0-1 gcc-6-base_6.4.0-1 gcc-7-base_7.1.0-9 gettext_0.19.8.1-2+b1 gettext-base_0.19.8.1-2+b1 glib-networking_2.50.0-1+b1 glib-networking-common_2.50.0-1 glib-networking-services_2.50.0-1+b1 gnome-icon-theme_3.12.0-2 gpgv_2.1.18-8 grep_2.27-2 groff-base_1.22.3-9 gsettings-desktop-schemas_3.22.0-1 gtk-update-icon-cache_3.22.16-1 gzip_1.6-5+b1 hicolor-icon-theme_0.15-1 hostname_3.18+b1 init-system-helpers_1.48 intltool-debian_0.35.0+20060710.4 jaligner_1.0+dfsg-4 java-common_0.59 javahelper_0.61 jellyfish_2.2.6-1+b2 libacl1_2.2.52-3+b1 libapt-pkg5.0_1.5~beta1 libarchive-zip-perl_1.59-1 libasan3_6.4.0-1 libasound2_1.1.3-5 libasound2-data_1.1.3-5 libasyncns0_0.8-6 libatk-bridge2.0-0_2.24.1-1 libatk-wrapper-java_0.33.3-13 libatk-wrapper-java-jni_0.33.3-13 libatk1.0-0_2.22.0-1 libatk1.0-data_2.22.0-1 libatomic1_7.1.0-9 libatspi2.0-0_2.24.1-1 libattr1_1:2.4.47-2+b2 libaudit-common_1:2.7.7-1 libaudit1_1:2.7.7-1+b1 libavahi-client3_0.6.32-2 libavahi-common-data_0.6.32-2 libavahi-common3_0.6.32-2 libblkid1_2.29.2-1 libbsd0_0.8.5-1 libbz2-1.0_1.0.6-8.1 libc-bin_2.24-12 libc-dev-bin_2.24-12 libc6_2.24-12 libc6-dev_2.24-12 libcairo-gobject2_1.14.10-1 libcairo2_1.14.10-1 libcap-ng0_0.7.7-3+b1 libcap2_1:2.25-1 libcc1-0_7.1.0-9 libcilkrts5_7.1.0-9 libclang-common-3.9-dev_1:3.9.1-10 libclang1-3.9_1:3.9.1-10 libcolord2_1.3.3-2 libcolt-free-java_1.2.0+dfsg-4 libcomerr2_1.43.4-2 libcommons-collections4-java_4.1-1 libconcurrent-java_1.3.4-4 libcroco3_0.6.12-1 libcups2_2.2.4-1 libcurl3-gnutls_7.52.1-5 libdatrie1_0.2.10-4+b1 libdb5.3_5.3.28-12+b1 libdbus-1-3_1.10.20-1 libdconf1_0.26.0-2+b1 libdebconfclient0_0.229 libdpkg-perl_1.18.24 libdrm2_2.4.81-2 libeatmydata1_105-5 libedit2_3.1-20170329-1 libegl1-mesa_17.1.4-1 libepoxy0_1.3.1-3 libexpat1_2.2.1-3 libfakeroot_1.21-3.1 libfdisk1_2.29.2-1 libffi6_3.2.1-6 libfile-homedir-perl_1.00-1 libfile-stripnondeterminism-perl_0.035-2 libfile-which-perl_1.21-1 libflac8_1.3.2-1 libfontconfig1_2.12.3-0.1 libfontenc1_1:1.1.3-1+b2 libfreetype6_2.8-0.2 libgbm1_17.1.4-1 libgc1c2_1:7.4.2-8 libgcc-6-dev_6.4.0-1 libgcc1_1:7.1.0-9 libgcrypt20_1.7.8-1 libgdbm3_1.8.3-14 libgdk-pixbuf2.0-0_2.36.5-2 libgdk-pixbuf2.0-common_2.36.5-2 libgetopt-java_1.0.14+dfsg-3 libgif7_5.1.4-0.4 libgl1-mesa-glx_17.1.4-1 libglapi-mesa_17.1.4-1 libglib2.0-0_2.52.3-1 libgmp10_2:6.1.2+dfsg-1 libgnutls30_3.5.13-2 libgomp1_7.1.0-9 libgpg-error0_1.27-3 libgraphite2-3_1.3.10-2 libgssapi-krb5-2_1.15-1 libgtk-3-0_3.22.16-1 libgtk-3-common_3.22.16-1 libgtk2.0-0_2.24.31-2 libgtk2.0-common_2.24.31-2 libharfbuzz0b_1.4.2-1 libhogweed4_3.3-1+b1 libhts-dev_1.4.1-2 libhts2_1.4.1-2 libice6_2:1.0.9-2 libicu57_57.1-6 libidn2-0_0.16-1+b1 libisl15_0.18-1 libitm1_7.1.0-9 libjbig0_2.1-3.1+b2 libjellyfish-2.0-2_2.2.6-1+b2 libjpeg62-turbo_1:1.5.1-2 libjs-jquery_3.1.1-2 libjson-glib-1.0-0_1.2.8-1 libjson-glib-1.0-common_1.2.8-1 libjsoncpp1_1.7.4-3 libjung-free-java_2.0.1+dfsg-1 libk5crypto3_1.15-1 libkeyutils1_1.5.9-9 libkrb5-3_1.15-1 libkrb5support0_1.15-1 liblcms2-2_2.8-4 libldap-2.4-2_2.4.44+dfsg-7 libldap-common_2.4.44+dfsg-7 libllvm3.9_1:3.9.1-10 liblsan0_7.1.0-9 liblz4-1_0.0~r131-2+b1 liblzma5_5.2.2-1.2+b1 libmagic-mgc_1:5.30-1 libmagic1_1:5.30-1 libmount1_2.29.2-1 libmpc3_1.0.3-1+b2 libmpdec2_2.4.2-1 libmpfr4_3.1.5-1 libmpx2_7.1.0-9 libncurses5_6.0+20161126-1 libncursesw5_6.0+20161126-1 libnettle6_3.3-1+b1 libnghttp2-14_1.24.0-1 libnspr4_2:4.15-1 libnss3_2:3.31-1 libobjc-6-dev_6.4.0-1 libobjc4_7.1.0-9 libogg0_1.3.2-1 libp11-kit0_0.23.7-2 libpam-modules_1.1.8-3.6 libpam-modules-bin_1.1.8-3.6 libpam-runtime_1.1.8-3.6 libpam0g_1.1.8-3.6 libpango-1.0-0_1.40.6-1 libpangocairo-1.0-0_1.40.6-1 libpangoft2-1.0-0_1.40.6-1 libpcre3_2:8.39-3 libpcsclite1_1.8.22-1 libperl5.24_5.24.1-6 libpipeline1_1.4.1-2 libpixman-1-0_0.34.0-1 libpng16-16_1.6.29-3 libproxy1v5_0.4.14-3 libpsl5_0.17.0-4+b1 libpulse0_10.0-2 libpython3-stdlib_3.5.3-3 libpython3.5-minimal_3.5.3-3 libpython3.5-stdlib_3.5.3-3 libquadmath0_7.1.0-9 libreadline7_7.0-3 librest-0.7-0_0.8.0-2 librsvg2-2_2.40.16-1+b1 librsvg2-common_2.40.16-1+b1 librtmp1_2.4+20151223.gitfa8646d.1-1+b1 libsasl2-2_2.1.27~101-g0780600+dfsg-3 libsasl2-modules-db_2.1.27~101-g0780600+dfsg-3 libselinux1_2.6-3+b2 libsemanage-common_2.6-2 libsemanage1_2.6-2+b1 libsepol1_2.6-2 libsigsegv2_2.11-1 libsm6_2:1.2.2-1+b3 libsmartcols1_2.29.2-1 libsndfile1_1.0.28-2 libsoup-gnome2.4-1_2.56.0-2 libsoup2.4-1_2.56.0-2 libsqlite3-0_3.16.2-5 libss2_1.43.4-2 libssh2-1_1.8.0-1 libssl1.1_1.1.0f-3 libstdc++-6-dev_6.4.0-1 libstdc++6_7.1.0-9 libsystemd0_233-10 libtasn1-6_4.12-2 libthai-data_0.1.26-1 libthai0_0.1.26-1 libtiff5_4.0.8-3 libtimedate-perl_2.3000-2 libtinfo5_6.0+20161126-1 libtool_2.4.6-2 libtsan0_7.1.0-9 libubsan0_7.1.0-9 libudev1_233-10 libunistring2_0.9.7-2 libustr-1.0-1_1.0.4-6 libuuid1_2.29.2-1 libvecmath-java_1.5.2-6 libvorbis0a_1.3.5-4 libvorbisenc2_1.3.5-4 libwayland-client0_1.12.0-1 libwayland-cursor0_1.12.0-1 libwayland-egl1-mesa_17.1.4-1 libwayland-server0_1.12.0-1 libwrap0_7.6.q-26 libx11-6_2:1.6.4-3 libx11-data_2:1.6.4-3 libx11-xcb1_2:1.6.4-3 libxau6_1:1.0.8-1 libxaw7_2:1.0.13-1+b2 libxcb-dri2-0_1.12-1 libxcb-dri3-0_1.12-1 libxcb-glx0_1.12-1 libxcb-present0_1.12-1 libxcb-render0_1.12-1 libxcb-shape0_1.12-1 libxcb-shm0_1.12-1 libxcb-sync1_1.12-1 libxcb-xfixes0_1.12-1 libxcb1_1.12-1 libxcomposite1_1:0.4.4-2 libxcursor1_1:1.1.14-1+b4 libxdamage1_1:1.1.4-2+b3 libxdmcp6_1:1.1.2-3 libxext6_2:1.3.3-1+b2 libxfixes3_1:5.0.3-1 libxft2_2.3.2-1+b2 libxi6_2:1.7.9-1 libxinerama1_2:1.1.3-1+b3 libxkbcommon0_0.7.1-1 libxml2_2.9.4+dfsg1-3 libxmu6_2:1.1.2-2 libxmuu1_2:1.1.2-2 libxpm4_1:3.5.12-1 libxrandr2_2:1.5.1-1 libxrender1_1:0.9.10-1 libxshmfence1_1.2-1+b2 libxt6_1:1.1.5-1 libxtst6_2:1.2.3-1 libxv1_2:1.0.11-1 libxxf86dga1_2:1.1.4-1+b3 libxxf86vm1_1:1.1.4-1+b2 linux-libc-dev_4.11.6-1 login_1:4.4-4.1 lsb-base_9.20161125 m4_1.4.18-1 make_4.1-9.1 man-db_2.7.6.1-2 mawk_1.3.3-17+b3 mime-support_3.60 mount_2.29.2-1 multiarch-support_2.24-12 ncurses-base_6.0+20161126-1 ncurses-bin_6.0+20161126-1 openjdk-8-jdk_8u131-b11-2 openjdk-8-jdk-headless_8u131-b11-2 openjdk-8-jre_8u131-b11-2 openjdk-8-jre-headless_8u131-b11-2 openssl_1.1.0f-3 parafly_0.0.2013.01.21-3+b1 passwd_1:4.4-4.1 patch_2.7.5-1+b2 perl_5.24.1-6 perl-base_5.24.1-6 perl-modules-5.24_5.24.1-6 po-debconf_1.0.20 python3_3.5.3-3 python3-minimal_3.5.3-3 python3.5_3.5.3-3 python3.5-minimal_3.5.3-3 readline-common_7.0-3 sbuild-build-depends-core-dummy_0.invalid.0 sbuild-build-depends-trinityrnaseq-dummy_0.invalid.0 sed_4.4-1 sensible-utils_0.0.9 shared-mime-info_1.8-1 sysvinit-utils_2.88dsf-59.9 tar_1.29b-1.1 ucf_3.0036 util-linux_2.29.2-1 x11-common_1:7.7+19 x11-utils_7.7+3+b1 xkb-data_2.19-1 xz-utils_5.2.2-1.2+b1 zlib1g_1:1.2.8.dfsg-5

+------------------------------------------------------------------------------+
| Build                                                                        |
+------------------------------------------------------------------------------+


Unpack source
-------------

gpgv: unknown type of key resource 'trustedkeys.kbx'
gpgv: keyblock resource '/sbuild-nonexistent/.gnupg/trustedkeys.kbx': General error
gpgv: Signature made Fri Aug  5 19:36:09 2016 UTC
gpgv:                using RSA key E8D37AE2F09F4872
gpgv: Can't check signature: No public key
dpkg-source: warning: failed to verify signature on ./trinityrnaseq_2.2.0+dfsg-2.dsc
dpkg-source: info: extracting trinityrnaseq in /<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg
dpkg-source: info: unpacking trinityrnaseq_2.2.0+dfsg.orig.tar.xz
dpkg-source: info: unpacking trinityrnaseq_2.2.0+dfsg-2.debian.tar.xz
dpkg-source: info: applying skip-kallisto-deseq2-tests
dpkg-source: info: applying noExitTester
dpkg-source: info: applying jellyfish-path
dpkg-source: info: applying update-paths
dpkg-source: info: applying collections15-to-4
dpkg-source: info: applying 0002-fix_istream_failure_call.patch
dpkg-source: info: applying fix_system_paths
dpkg-source: info: applying disable-version-check
dpkg-source: info: applying adjust-trimmomatic-adapters-path
dpkg-source: info: applying build_with_gcc6.patch

Check disk space
----------------

Sufficient free space for build

User Environment
----------------

APT_CONFIG=/var/lib/sbuild/apt.conf
HOME=/sbuild-nonexistent
LANG=en_US.UTF-8
LC_ALL=POSIX
LOGNAME=user42
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SCHROOT_ALIAS_NAME=unstable-amd64-sbuild
SCHROOT_CHROOT_NAME=unstable-amd64-sbuild
SCHROOT_COMMAND=env
SCHROOT_GID=1001
SCHROOT_GROUP=user42
SCHROOT_SESSION_ID=unstable-amd64-sbuild-37b827a9-8613-4432-bf06-218aed5415bb
SCHROOT_UID=1001
SCHROOT_USER=user42
SHELL=/bin/sh
USER=user42

dpkg-buildpackage
-----------------

dpkg-buildpackage: info: source package trinityrnaseq
dpkg-buildpackage: info: source version 2.2.0+dfsg-2
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Sascha Steinbiss <satta@debian.org>
 dpkg-source --before-build trinityrnaseq-2.2.0+dfsg
dpkg-buildpackage: info: host architecture amd64
 fakeroot debian/rules clean
dh clean --parallel --with javahelper,autoreconf
   dh_testdir -O--parallel
   debian/rules override_dh_auto_clean
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
for target in Inchworm Chrysalis trinity-plugins/*Fastool* trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs; do dh_auto_clean \
	--sourcedirectory=${target}; done
	make -j16 clean
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Chrysalis'
Makefile:80: ----------------------------------------------------------
Makefile:81: using g++ version 4.2.1 
Makefile:82: --------------------------------------------------------
clang: error: unknown argument: '-fno-nonansi-builtins'
make[2]: *** [MakeDepend] Error 1
for file in ; do rm -f ./$file; done
rm -f MakeDepend ./MakeDepend contigs.out my.permanent.log.file \
             core a.out Makefile.bak bsubin BasevectorTables.h ./checkLock 
find obj -name '*.o' -exec rm {} \; || /bin/true
find: 'obj': No such file or directory
rm -rf cxx_repository
rm -f lib_*_temp.a
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Chrysalis'
	make -j16 clean
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/fstrozzi-Fastool-7c3e034f05'
rm -f *.o fastool
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/fstrozzi-Fastool-7c3e034f05'
	make -j16 clean
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
X=`pwd`; \
for i in src; \
do echo '<<<' $i '>>>'; cd $X/$i; make clean; done
<<< src >>>
make[3]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
rm -f slcluster.o graph.o graphnode.o cmd_line_opts.o core a.out *~ \#* slclust Makefile.bak \
	../bin/slclust
make[3]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
	make -j16 clean
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/scaffold_iworm_contigs'
rm -f scaffold_iworm_contigs
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/scaffold_iworm_contigs'
rm --force Chrysalis/Makefile_auto
rm --force trinity-plugins/slclust/bin/slclust
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
   jh_clean -O--parallel
   dh_autoreconf_clean -O--parallel
   dh_clean -O--parallel
 debian/rules build-arch
dh build-arch --parallel --with javahelper,autoreconf
   dh_testdir -a -O--parallel
   dh_update_autotools_config -a -O--parallel
   dh_autoreconf -a -O--parallel
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
for target in Inchworm Chrysalis trinity-plugins/*Fastool* trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs; do dh_auto_configure \
	--sourcedirectory=${target} -- \
	--prefix=/usr/lib/trinityrnaseq/${target} \
	CFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" CPPFLAGS="-Wdate-time -D_FORTIFY_SOURCE=2" CXXFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" FCFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" FFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" GCJFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" LDFLAGS="-Wl,-z,relro -Wl,-z,now" OBJCFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" OBJCXXFLAGS="-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" ; done
	./configure --build=x86_64-linux-gnu --prefix=/usr --includedir=\${prefix}/include --mandir=\${prefix}/share/man --infodir=\${prefix}/share/info --sysconfdir=/etc --localstatedir=/var --disable-silent-rules --libdir=\${prefix}/lib/x86_64-linux-gnu --libexecdir=\${prefix}/lib/x86_64-linux-gnu --disable-maintainer-mode --disable-dependency-tracking --prefix=/usr/lib/trinityrnaseq/Inchworm "CFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" "CPPFLAGS=-Wdate-time -D_FORTIFY_SOURCE=2" "CXXFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" "FCFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" "FFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" "GCJFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong" "LDFLAGS=-Wl,-z,relro -Wl,-z,now" "OBJCFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security" "OBJCXXFLAGS=-g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security"
configure: WARNING: unrecognized options: --disable-maintainer-mode
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... no
checking for mawk... mawk
checking whether make sets $(MAKE)... yes
checking whether make supports nested variables... yes
checking for g++... g++
checking whether the C++ compiler works... yes
checking for C++ compiler default output file name... a.out
checking for suffix of executables... 
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... none
checking for library containing cos... none required
checking that generated files are newer than configure... done
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: executing depfiles commands
configure: WARNING: unrecognized options: --disable-maintainer-mode
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
   jh_linkjars -a -O--parallel
   debian/rules override_dh_auto_build
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
for target in Inchworm Chrysalis trinity-plugins/*Fastool* trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs; do dh_auto_build \
	-O--sourcedirectory=${target}; done
	make -j16
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
(CDPATH="${ZSH_VERSION+.}:" && cd . && /bin/bash /<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm/missing autoheader)
rm -f stamp-h1
touch config.h.in
cd . && /bin/bash ./config.status config.h
config.status: creating config.h
config.status: config.h is unchanged
make  all-recursive
make[3]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
Making all in src
make[4]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o Fasta_entry.o Fasta_entry.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o IRKE_run.o IRKE_run.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o sequenceUtil.o sequenceUtil.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o IRKE.o IRKE.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o KmerCounter.o KmerCounter.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o string_util.o string_util.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o Fasta_reader.o Fasta_reader.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o stacktrace.o stacktrace.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o argProcessor.o argProcessor.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o cigar_tweaker.o cigar_tweaker.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o SAM_entry.o SAM_entry.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o SAM_reader.o SAM_reader.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o Cigar.o Cigar.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o DeBruijnGraph.o DeBruijnGraph.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
IRKE_run.cpp:9:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
Fasta_reader.cpp:5:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'Fasta_reader.o' failed
make[4]: *** [Fasta_reader.o] Error 1
make[4]: *** Waiting for unfinished jobs....
FastaToDeBruijn.cpp:18:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'FastaToDeBruijn.o' failed
make[4]: *** [FastaToDeBruijn.o] Error 1
1 error generated.
IRKE.cpp:14:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
Makefile:431: recipe for target 'IRKE_run.o' failed
make[4]: *** [IRKE_run.o] Error 1
KmerCounter.cpp:11:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'KmerCounter.o' failed
make[4]: *** [KmerCounter.o] Error 1
1 error generated.
Makefile:431: recipe for target 'IRKE.o' failed
make[4]: *** [IRKE.o] Error 1
fastaToKmerCoverageStats.cpp:13:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'fastaToKmerCoverageStats.o' failed
make[4]: *** [fastaToKmerCoverageStats.o] Error 1
make[4]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm/src'
Makefile:349: recipe for target 'all-recursive' failed
make[3]: *** [all-recursive] Error 1
make[3]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
Makefile:290: recipe for target 'all' failed
make[2]: *** [all] Error 2
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
dh_auto_build: make -j16 returned exit code 2
	make -j16
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Chrysalis'
Makefile:80: ----------------------------------------------------------
Makefile:81: using g++ version 4.2.1 
Makefile:82: --------------------------------------------------------
clang: error: unknown argument: '-fno-nonansi-builtins'
make[2]: *** [MakeDepend] Error 1
make[2]: Nothing to be done for 'all'.
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Chrysalis'
	make -j16
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/fstrozzi-Fastool-7c3e034f05'
cc -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -O2 -std=c99 -Werror -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now fastool.c -o fastool
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/fstrozzi-Fastool-7c3e034f05'
	make -j16
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
X=`pwd`; \
for i in src; \
do echo '<<<' $i '>>>'; cd $X/$i; make all; done
<<< src >>>
make[3]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
g++ -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -I../include -Wall  -Wdate-time -D_FORTIFY_SOURCE=2  -c -o slcluster.o slcluster.cpp
g++ -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -I../include -Wall  -Wdate-time -D_FORTIFY_SOURCE=2  -c -o graph.o graph.cpp
g++ -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -I../include -Wall  -Wdate-time -D_FORTIFY_SOURCE=2  -c -o graphnode.o graphnode.cpp
g++ -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -I../include -Wall  -Wdate-time -D_FORTIFY_SOURCE=2  -c -o cmd_line_opts.o cmd_line_opts.cpp
In file included from cmd_line_opts.cpp:1:
../include/cmd_line_opts.h:1:9: warning: '__CMD_LINE_OPTS_H__' is used as a header guard here, followed by #define of a different macro [-Wheader-guard]
#ifndef __CMD_LINE_OPTS_H__
        ^~~~~~~~~~~~~~~~~~~
../include/cmd_line_opts.h:2:9: note: '__CMD_LiNE_OPTS_H__' is defined here; did you mean '__CMD_LINE_OPTS_H__'?
#define __CMD_LiNE_OPTS_H__
        ^~~~~~~~~~~~~~~~~~~
        __CMD_LINE_OPTS_H__
In file included from slcluster.cpp:4:
../include/cmd_line_opts.h:1:9: warning: '__CMD_LINE_OPTS_H__' is used as a header guard here, followed by #define of a different macro [-Wheader-guard]
#ifndef __CMD_LINE_OPTS_H__
        ^~~~~~~~~~~~~~~~~~~
../include/cmd_line_opts.h:2:9: note: '__CMD_LiNE_OPTS_H__' is defined here; did you mean '__CMD_LINE_OPTS_H__'?
#define __CMD_LiNE_OPTS_H__
        ^~~~~~~~~~~~~~~~~~~
        __CMD_LINE_OPTS_H__
1 warning generated.
1 warning generated.
g++ -Wl,-z,relro -Wl,-z,now slcluster.o graph.o graphnode.o cmd_line_opts.o  -o slclust
chmod 755 slclust
make[3]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
	make -j16
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/scaffold_iworm_contigs'
g++ -Wl,-z,relro -Wl,-z,now -I../htslib -L../htslib ScaffoldIwormContigs.cpp error_checker.cpp -lhts -o scaffold_iworm_contigs
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/scaffold_iworm_contigs'
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
   jh_build -a -O--parallel
find Butterfly/src/src -name *.java -and -type f -print0 | xargs -s 512000 -0 /usr/lib/jvm/default-java/bin/javac -g -cp /usr/share/java/commons-collections4.jar:/usr/share/java/gnu-getopt.jar:/usr/share/java/jung-algorithms.jar:/usr/share/java/jung-api.jar:/usr/share/java/jung-graph-impl.jar:/usr/share/java/jaligner.jar:debian/_jh_build.Butterfly -d debian/_jh_build.Butterfly -source 1.7 -target 1.7 -encoding ISO8859-1
warning: [options] bootstrap class path not set in conjunction with -source 1.7
Note: Some input files use unchecked or unsafe operations.
Note: Recompile with -Xlint:unchecked for details.
1 warning
find Butterfly/src/src -name *.java -and -type f -print0 | xargs -s 512000 -0 /usr/lib/jvm/default-java/bin/javadoc -locale en_US -classpath /usr/share/java/commons-collections4.jar:/usr/share/java/gnu-getopt.jar:/usr/share/java/jung-algorithms.jar:/usr/share/java/jung-api.jar:/usr/share/java/jung-graph-impl.jar:/usr/share/java/jaligner.jar:debian/_jh_build.Butterfly -d debian/_jh_build.javadoc/api -quiet -encoding ISO8859-1 -notimestamp -source 1.7
Butterfly/src/src/GraphPath.java:42: warning - @return tag has no arguments.
Butterfly/src/src/My_DFS.java:563: warning - @return tag has no arguments.
Butterfly/src/src/My_DFS.java:32: warning - @param argument "roots" is not a parameter name.
Butterfly/src/src/PairPath.java:178: warning - @return tag has no arguments.
Butterfly/src/src/PairPath.java:126: warning - @param argument "isCircular" is not a parameter name.
Butterfly/src/src/Read.java:62: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:70: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:78: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:88: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:96: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:104: warning - @return tag has no arguments.
Butterfly/src/src/Read.java:20: warning - @param argument "toV" is not a parameter name.
Butterfly/src/src/SeqVertex.java:373: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:413: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:421: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:429: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:469: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:493: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:521: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:655: warning - @return tag has no arguments.
Butterfly/src/src/SeqVertex.java:84: warning - @param argument "nextID" is not a parameter name.
Butterfly/src/src/SeqVertex.java:84: warning - @param argument "l" is not a parameter name.
Butterfly/src/src/SeqVertex.java:157: warning - @param argument "_origButterflyID" is not a parameter name.
Butterfly/src/src/SeqVertex.java:771: warning - @param argument "name" is not a parameter name.
Butterfly/src/src/SeqVertex.java:771: warning - @param argument "weight" is not a parameter name.
Butterfly/src/src/SeqVertex.java:771: warning - @param argument "name2" is not a parameter name.
Butterfly/src/src/SeqVertex.java:771: warning - @param argument "weight2" is not a parameter name.
Butterfly/src/src/TransAssembly_allProbPaths.java:14478: warning - @return tag has no arguments.
Butterfly/src/src/TransAssembly_allProbPaths.java:14478: warning - @param argument "candidateNodes" is not a parameter name.
Butterfly/src/src/TransAssembly_allProbPaths.java:14478: warning - @param argument "l" is not a parameter name.
30 warnings
/usr/lib/jvm/default-java/bin/jar cfm /<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Butterfly.jar ../_jh_manifest.Butterfly AlignmentStats.class BFLY_GLOBALS.class BipartiteMatching.class DFS.class GraphPath.class IsoformExpressionLearning.class ListComparator.class LocInGraph.class My_DFS$1.class My_DFS$2.class My_DFS.class NWalign.class NumPathNodeLoopsEdgeComparator.class PairPath.class PairPathWOrig.class PasaVertex$1.class PasaVertex.class Path.class PathEndSeqVertexFinishTimeComparator.class PathExpressionComparator.class PathOverlap.class PathReadSupportComparator.class PathWithOrig.class Path_n_MM_count$Vertex_path_position.class Path_n_MM_count.class Read.class ScoredPath.class SeqComparator.class SeqVertex.class SeqVertexDepthComparator.class SeqVertexFinishTimeComparator.class SeqVertexNodeDepthComparator.class SimpleEdge.class SimpleEdgeComparator.class SimplePathNodeEdge.class TopologicalSort.class TransAssembly_allProbPaths$1.class TransAssembly_allProbPaths$10.class TransAssembly_allProbPaths$11.class TransAssembly_allProbPaths$12.class TransAssembly_allProbPaths$13.class TransAssembly_allProbPaths$14.class TransAssembly_allProbPaths$15.class TransAssembly_allProbPaths$16.class TransAssembly_allProbPaths$17.class TransAssembly_allProbPaths$18.class TransAssembly_allProbPaths$19.class TransAssembly_allProbPaths$2.class TransAssembly_allProbPaths$20.class TransAssembly_allProbPaths$3.class TransAssembly_allProbPaths$4.class TransAssembly_allProbPaths$5.class TransAssembly_allProbPaths$6.class TransAssembly_allProbPaths$7.class TransAssembly_allProbPaths$8.class TransAssembly_allProbPaths$9.class TransAssembly_allProbPaths$FinalPaths.class TransAssembly_allProbPaths.class UniquePathContentComparator.class Visitor.class ZipperAlignment.class edu numLoopsEdgeComparator.class
   debian/rules override_dh_auto_test
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
java -cp Butterfly.jar TransAssembly_allProbPaths -N 100 -L 100 -F 300 \
	-C Butterfly/src/sample_data/RawComps.0/comp0 --stderr -V 18
Started
using Path alignment for path comparisons
combine paths if (identity=(numberOfMatches/shorterLen) > 98.0% or if we have <= 2 mismatches) and if we have internal gap lengths <= 10
path reinforcement distance computed based on 25% of max pair distance: 300 = 75 bases
SECTION
================
Parsing de Bruijn graph
======================

preProcessGraphFile: Butterfly/src/sample_data/RawComps.0/comp0.out
SECTION
==================
buildNewGraph
========================

buildNewGraphFirstLetter: Butterfly/src/sample_data/RawComps.0/comp0.out
KMER_SIZE=24

[17]  
[34]  
[51]  
[68]  
[85]  
[102]  
[119]  
[136]  
[153]  
[170]  
[187]  
[204]  
[221]  
[238]  
[255]  
[272]  
[289]  
[306]  
[323]  
[340]  
[357]  
[374]  
[391]  
[408]  
[425]  
[442]  
[459]  
[476]  
[493]  
[510]  
[527]  
[544]  
[561]  
[578]  
[595]  
[612]  
[629]  
[646]  
[663]  
[680]  
[697]  
[714]  
[731]  
[748]  
[765]  Graph is built
fixExtremeleyHighSingleEdges()
fixExtremelyHighSingleEdges()
removeLightEdges()
removeLightEdges()
SECTION
=================
REMOVING LIGHT In EDGES
=================
SECTION
=================
REMOVING LIGHT OUT EDGES
=================
SECTION
=================
REMOVING LIGHT FLOW EDGES
=================
compactLinearPaths()
SECTION
=================
COMPACTING THE GRAPH
=================
SNP_collapse candidates: TCAGAACAGTCATTGATATTCTTT:W5(V337_D1) len: 24 and CCAGAACAGTC:W21(V104_D1) len: 11
SECTION
====================
Removing small components.
====================


ComponentDivision: 0 contains the following vertices:
node_id: 0
node_id: 128
node_id: 337
node_id: 115
node_id: 104
node_id: 361
number of good components: 1

SECTION
====================
Threading reads through the graph
=========================



Threading read: SRR039231.14043245_FC42DB6AAXX:2:78:825:704, length: 75, allowing for 4 max mismatches.
Read SRR039231.14043245_FC42DB6AAXX:2:78:825:704 seq TAAAGGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:75,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.14043245_FC42DB6AAXX:2:78:825:704 : [0]
ReadPath@Init: SRR039231.14043245_FC42DB6AAXX:2:78:825:704 : [0]


Threading read: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794, length: 74, allowing for 4 max mismatches.
Read SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 seq AGGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:77,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 : [0]
ReadPath@Init: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 : [0]


Threading read: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158, length: 74, allowing for 4 max mismatches.
Read SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 seq AGGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:77,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 : [0]
ReadPath@Init: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 : [0]


Threading read: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027, length: 74, allowing for 4 max mismatches.
Read SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 seq GGGGATCATGGTCTGAACGGAAGTTCATGANACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0] positions:  [0,nodeEnd:78,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 : [0]
ReadPath@Init: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 : [0]


Threading read: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256, length: 65, allowing for 4 max mismatches.
Read SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 seq AGGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:68,readEnd:65] , trimmed to: [0]
Threaded Read as: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 : [0]
ReadPath@Init: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 : [0]


Threading read: SRR039231.238223_FC42DB6AAXX:2:2:467:595, length: 74, allowing for 4 max mismatches.
Read SRR039231.238223_FC42DB6AAXX:2:2:467:595 seq GGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:78,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.238223_FC42DB6AAXX:2:2:467:595 : [0]
ReadPath@Init: SRR039231.238223_FC42DB6AAXX:2:2:467:595 : [0]


Threading read: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969, length: 59, allowing for 3 max mismatches.
Read SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 seq AACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:78,readEnd:59] , trimmed to: [0]
Threaded Read as: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 : [0]
ReadPath@Init: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 : [0]


Threading read: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615, length: 75, allowing for 4 max mismatches.
Read SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 seq GGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:79,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 : [0]
ReadPath@Init: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 : [0]


Threading read: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278, length: 59, allowing for 3 max mismatches.
Read SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 seq GGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:63,readEnd:59] , trimmed to: [0]
Threaded Read as: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 : [0]
ReadPath@Init: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 : [0]


Threading read: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587, length: 59, allowing for 3 max mismatches.
Read SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 seq GGGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:63,readEnd:59] , trimmed to: [0]
Threaded Read as: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 : [0]
ReadPath@Init: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 : [0]


Threading read: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090, length: 61, allowing for 4 max mismatches.
Read SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 seq GGGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:66,readEnd:61] , trimmed to: [0]
Threaded Read as: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 : [0]
ReadPath@Init: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 : [0]


Threading read: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133, length: 75, allowing for 4 max mismatches.
Read SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 seq GGATCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:81,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 : [0]
ReadPath@Init: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 : [0]


Threading read: SRR039231.1282721_FC42DB6AAXX:2:7:1475:1500, length: 75, allowing for 4 max mismatches.
Read SRR039231.1282721_FC42DB6AAXX:2:7:1475:1500 seq ATCATGGTCTGAACGGAAGTTCATGATAACTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0] positions:  [0,nodeEnd:83,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.1282721_FC42DB6AAXX:2:7:1475:1500 : [0]
ReadPath@Init: SRR039231.1282721_FC42DB6AAXX:2:7:1475:1500 : [0]


Threading read: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638, length: 74, allowing for 4 max mismatches.
Read SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 seq TCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:83,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 : [0]
ReadPath@Init: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 : [0]


Threading read: SRR039231.2103331_FC42DB6AAXX:2:12:391:1567, length: 75, allowing for 4 max mismatches.
Read SRR039231.2103331_FC42DB6AAXX:2:12:391:1567 seq TCATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:84,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.2103331_FC42DB6AAXX:2:12:391:1567 : [0]
ReadPath@Init: SRR039231.2103331_FC42DB6AAXX:2:12:391:1567 : [0]


Threading read: SRR039231.892387_FC42DB6AAXX:2:5:1324:1026, length: 75, allowing for 4 max mismatches.
Read SRR039231.892387_FC42DB6AAXX:2:5:1324:1026 seq TCATGGTCTGAACGGAAGTTCATGATGCCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0] positions:  [0,nodeEnd:84,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.892387_FC42DB6AAXX:2:5:1324:1026 : [0]
ReadPath@Init: SRR039231.892387_FC42DB6AAXX:2:5:1324:1026 : [0]


Threading read: SRR039231.5276511_FC42DB6AAXX:2:29:797:1951, length: 70, allowing for 4 max mismatches.
Read SRR039231.5276511_FC42DB6AAXX:2:29:797:1951 seq TCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:85,readEnd:70] , trimmed to: [0]
Threaded Read as: SRR039231.5276511_FC42DB6AAXX:2:29:797:1951 : [0]
ReadPath@Init: SRR039231.5276511_FC42DB6AAXX:2:29:797:1951 : [0]


Threading read: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016, length: 70, allowing for 4 max mismatches.
Read SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 seq ATGGTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:81,readEnd:70] , trimmed to: [0]
Threaded Read as: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 : [0]
ReadPath@Init: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 : [0]


Threading read: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547, length: 74, allowing for 4 max mismatches.
Read SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 seq GTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:88,readEnd:74] , trimmed to: [0]
Threaded Read as: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 : [0]
ReadPath@Init: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 : [0]


Threading read: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849, length: 75, allowing for 4 max mismatches.
Read SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 seq GTCTGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:89,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 : [0]
ReadPath@Init: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 : [0]


Threading read: SRR039231.13448095_FC42DB6AAXX:2:75:280:1746, length: 75, allowing for 4 max mismatches.
Read SRR039231.13448095_FC42DB6AAXX:2:75:280:1746 seq TGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:92,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.13448095_FC42DB6AAXX:2:75:280:1746 : [0]
ReadPath@Init: SRR039231.13448095_FC42DB6AAXX:2:75:280:1746 : [0]


Threading read: SRR039231.14173065_FC42DB6AAXX:2:79:322:765, length: 75, allowing for 4 max mismatches.
Read SRR039231.14173065_FC42DB6AAXX:2:79:322:765 seq TGAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:92,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.14173065_FC42DB6AAXX:2:79:322:765 : [0]
ReadPath@Init: SRR039231.14173065_FC42DB6AAXX:2:79:322:765 : [0]


Threading read: SRR039231.6669437_FC42DB6AAXX:2:37:324:1344, length: 69, allowing for 4 max mismatches.
Read SRR039231.6669437_FC42DB6AAXX:2:37:324:1344 seq GAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:92,readEnd:69] , trimmed to: [0]
Threaded Read as: SRR039231.6669437_FC42DB6AAXX:2:37:324:1344 : [0]
ReadPath@Init: SRR039231.6669437_FC42DB6AAXX:2:37:324:1344 : [0]


Threading read: SRR039231.18849210_FC42DB6AAXX:2:104:1359:1828, length: 75, allowing for 4 max mismatches.
Read SRR039231.18849210_FC42DB6AAXX:2:104:1359:1828 seq GAACGGAAGTTCATGATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:93,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.18849210_FC42DB6AAXX:2:104:1359:1828 : [0]
ReadPath@Init: SRR039231.18849210_FC42DB6AAXX:2:104:1359:1828 : [0]


Threading read: SRR039231.238223_FC42DB6AAXX:2:2:467:595, length: 75, allowing for 4 max mismatches.
Read SRR039231.238223_FC42DB6AAXX:2:2:467:595 seq GATACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:107,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.238223_FC42DB6AAXX:2:2:467:595 : [0]
ReadPath@Init: SRR039231.238223_FC42DB6AAXX:2:2:467:595 : [0]


Threading read: SRR039231.19732435_FC42DB6AAXX:2:109:1038:1442, length: 75, allowing for 4 max mismatches.
Read SRR039231.19732435_FC42DB6AAXX:2:109:1038:1442 seq TACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:109,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.19732435_FC42DB6AAXX:2:109:1038:1442 : [0]
ReadPath@Init: SRR039231.19732435_FC42DB6AAXX:2:109:1038:1442 : [0]


Threading read: SRR039231.21589259_FC42DB6AAXX:2:119:947:546, length: 75, allowing for 4 max mismatches.
Read SRR039231.21589259_FC42DB6AAXX:2:119:947:546 seq ACCTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:110,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.21589259_FC42DB6AAXX:2:119:947:546 : [0]
ReadPath@Init: SRR039231.21589259_FC42DB6AAXX:2:119:947:546 : [0]


Threading read: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833, length: 75, allowing for 4 max mismatches.
Read SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 seq CTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:112,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 : [0]
ReadPath@Init: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 : [0]


Threading read: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177, length: 75, allowing for 4 max mismatches.
Read SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 seq CTAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:112,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 : [0]
ReadPath@Init: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 : [0]


Threading read: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867, length: 68, allowing for 4 max mismatches.
Read SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 seq TAGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:106,readEnd:68] , trimmed to: [0]
Threaded Read as: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 : [0]
ReadPath@Init: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 : [0]


Threading read: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027, length: 75, allowing for 4 max mismatches.
Read SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 seq AGAATAATAATTATGATATGATGGTGGATCTAGAAGAGGCNTCTGGTACATTTCATGGCTGAGAAAACATTTTTG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0] positions:  [0,nodeEnd:114,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 : [0]
ReadPath@Init: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 : [0]


Threading read: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536, length: 64, allowing for 4 max mismatches.
Read SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 seq ATAATAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:106,readEnd:64] , trimmed to: [0]
Threaded Read as: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 : [0]
ReadPath@Init: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 : [0]


Threading read: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794, length: 75, allowing for 4 max mismatches.
Read SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 seq TAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:121,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 : [0]
ReadPath@Init: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 : [0]


Threading read: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615, length: 75, allowing for 4 max mismatches.
Read SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 seq TAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:121,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 : [0]
ReadPath@Init: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 : [0]


Threading read: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278, length: 75, allowing for 4 max mismatches.
Read SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 seq TAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:121,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 : [0]
ReadPath@Init: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 : [0]


Threading read: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969, length: 75, allowing for 4 max mismatches.
Read SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 seq TAATTATGATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:121,readEnd:75] , trimmed to: [0]
Threaded Read as: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 : [0]
ReadPath@Init: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 : [0]


Threading read: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090, length: 75, allowing for 4 max mismatches.
Read SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 seq GATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:74] [337,nodeEnd:24,readEnd:75] , trimmed to: [0, 337]
Threaded Read as: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 : [0, 337]
ReadPath@Init: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 : [0, 337]


Threading read: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849, length: 75, allowing for 4 max mismatches.
Read SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 seq GATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:74] [104,nodeEnd:24,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 : [0, 104]
ReadPath@Init: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 : [0, 104]


Threading read: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158, length: 75, allowing for 4 max mismatches.
Read SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 seq ATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:73] [104,nodeEnd:25,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 : [0, 104]
ReadPath@Init: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 : [0, 104]


Threading read: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016, length: 74, allowing for 4 max mismatches.
Read SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 seq ATATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:73] [104,nodeEnd:24,readEnd:74] , trimmed to: [0, 104]
Threaded Read as: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 : [0, 104]
ReadPath@Init: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 : [0, 104]


Threading read: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547, length: 75, allowing for 4 max mismatches.
Read SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 seq ATGATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:71] [104,nodeEnd:27,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 : [0, 104]
ReadPath@Init: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 : [0, 104]


Threading read: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638, length: 75, allowing for 4 max mismatches.
Read SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 seq GATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:69] [337,nodeEnd:29,readEnd:75] , trimmed to: [0, 337]
Threaded Read as: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 : [0, 337]
ReadPath@Init: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 : [0, 337]


Threading read: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587, length: 75, allowing for 4 max mismatches.
Read SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 seq GATGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:69] [104,nodeEnd:29,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 : [0, 104]
ReadPath@Init: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 : [0, 104]


Threading read: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288, length: 75, allowing for 4 max mismatches.
Read SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 seq TGGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:67] [104,nodeEnd:31,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 : [0, 104]
ReadPath@Init: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 : [0, 104]


Threading read: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333, length: 72, allowing for 4 max mismatches.
Read SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 seq GGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:66] [104,nodeEnd:29,readEnd:72] , trimmed to: [0, 104]
Threaded Read as: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 : [0, 104]
ReadPath@Init: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 : [0, 104]


Threading read: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450, length: 53, allowing for 3 max mismatches.
Read SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 seq GGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAACAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:44] [337,nodeEnd:32,readEnd:53] , trimmed to: [0, 337]
Threaded Read as: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 : [0, 337]
ReadPath@Init: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 : [0, 337]


Threading read: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595, length: 72, allowing for 4 max mismatches.
Read SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 seq GGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:66] [337,nodeEnd:29,readEnd:72] , trimmed to: [0, 337]
Threaded Read as: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 : [0, 337]
ReadPath@Init: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 : [0, 337]


Threading read: SRR039231.2140780_FC42DB6AAXX:2:12:746:731, length: 56, allowing for 3 max mismatches.
Read SRR039231.2140780_FC42DB6AAXX:2:12:746:731 seq GGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:117,readEnd:56] , trimmed to: [0]
Threaded Read as: SRR039231.2140780_FC42DB6AAXX:2:12:746:731 : [0]
ReadPath@Init: SRR039231.2140780_FC42DB6AAXX:2:12:746:731 : [0]


Threading read: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289, length: 69, allowing for 4 max mismatches.
Read SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 seq GGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:66] [104,nodeEnd:26,readEnd:69] , trimmed to: [0, 104]
Threaded Read as: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 : [0, 104]
ReadPath@Init: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 : [0, 104]


Threading read: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566, length: 57, allowing for 3 max mismatches.
Read SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 seq GGTGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0] positions:  [0,nodeEnd:118,readEnd:57] , trimmed to: [0]
Threaded Read as: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 : [0]
ReadPath@Init: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 : [0]


Threading read: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161, length: 70, allowing for 4 max mismatches.
Read SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 seq TCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAACAGT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:60] [337,nodeEnd:33,readEnd:70] , trimmed to: [0, 337]
Threaded Read as: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 : [0, 337]
ReadPath@Init: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 : [0, 337]


Threading read: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256, length: 75, allowing for 4 max mismatches.
Read SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 seq TGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:64] [104,nodeEnd:34,readEnd:75] , trimmed to: [0, 104]
Threaded Read as: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 : [0, 104]
ReadPath@Init: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 : [0, 104]


Threading read: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133, length: 75, allowing for 4 max mismatches.
Read SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 seq TGGATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAACAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:64] [337,nodeEnd:34,readEnd:75] , trimmed to: [0, 337]
Threaded Read as: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 : [0, 337]
ReadPath@Init: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 : [0, 337]


Threading read: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457, length: 75, allowing for 4 max mismatches.
Read SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 seq GATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAATCAGAACAGTCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 337] positions:  [0,nodeEnd:127,readEnd:62] [337,nodeEnd:36,readEnd:75] , trimmed to: [0, 337]
Threaded Read as: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 : [0, 337]
ReadPath@Init: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 : [0, 337]


Threading read: SRR039231.21001541_FC42DB6AAXX:2:116:708:497, length: 75, allowing for 4 max mismatches.
Read SRR039231.21001541_FC42DB6AAXX:2:116:708:497 seq ATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:61] [104,nodeEnd:34,readEnd:72] [115,nodeEnd:26,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.21001541_FC42DB6AAXX:2:116:708:497 : [0, 104, 115]
ReadPath@Init: SRR039231.21001541_FC42DB6AAXX:2:116:708:497 : [0, 104, 115]


Threading read: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375, length: 75, allowing for 4 max mismatches.
Read SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 seq ATCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:61] [104,nodeEnd:34,readEnd:72] [115,nodeEnd:26,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 : [0, 104, 115]
ReadPath@Init: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 : [0, 104, 115]


Threading read: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254, length: 74, allowing for 4 max mismatches.
Read SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 seq TCTAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:60] [104,nodeEnd:34,readEnd:71] [115,nodeEnd:26,readEnd:74] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 : [0, 104, 115]
ReadPath@Init: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 : [0, 104, 115]


Threading read: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346, length: 75, allowing for 4 max mismatches.
Read SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 seq TAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:58] [104,nodeEnd:34,readEnd:69] [115,nodeEnd:29,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 : [0, 104, 115]
ReadPath@Init: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 : [0, 104, 115]


Threading read: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604, length: 67, allowing for 4 max mismatches.
Read SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 seq TAGAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:58] [104,nodeEnd:32,readEnd:67] , trimmed to: [0, 104]
Threaded Read as: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 : [0, 104]
ReadPath@Init: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 : [0, 104]


Threading read: SRR039231.14735089_FC42DB6AAXX:2:82:509:413, length: 75, allowing for 4 max mismatches.
WARNING, Tied paths from vertex [V0 ]: 
Path A:
PATH_N_MM_COUNT: mismatches=0, path= [104, 115] positions:  [104,nodeEnd:34,readEnd:67] [115,nodeEnd:31,readEnd:75] 
vs. Path B:
PATH_N_MM_COUNT: mismatches=1, path= [337] positions:  [337,nodeEnd:42,readEnd:75] 
WARNING: TIED_READ_PATH
Read SRR039231.14735089_FC42DB6AAXX:2:82:509:413 seq GAAGAGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTTATGGTTTGATGAACCAGAACAGTCATTGATAT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:56] [104,nodeEnd:34,readEnd:67] [115,nodeEnd:31,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.14735089_FC42DB6AAXX:2:82:509:413 : [0, 104, 115]
ReadPath@Init: SRR039231.14735089_FC42DB6AAXX:2:82:509:413 : [0, 104, 115]


Threading read: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833, length: 75, allowing for 4 max mismatches.
Read SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 seq AGGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:52] [104,nodeEnd:34,readEnd:63] [115,nodeEnd:35,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 : [0, 104, 115]
ReadPath@Init: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 : [0, 104, 115]


Threading read: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177, length: 75, allowing for 4 max mismatches.
WARNING, Tied paths from vertex [V0 ]: 
Path A:
PATH_N_MM_COUNT: mismatches=0, path= [104, 115] positions:  [104,nodeEnd:34,readEnd:62] [115,nodeEnd:36,readEnd:75] 
vs. Path B:
PATH_N_MM_COUNT: mismatches=1, path= [337] positions:  [337,nodeEnd:47,readEnd:75] 
WARNING: TIED_READ_PATH
Read SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 seq GGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGGTGGTTTGATGAACCAGAACAGTCATTGATATTCTTT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:51] [104,nodeEnd:34,readEnd:62] [115,nodeEnd:36,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 : [0, 104, 115]
ReadPath@Init: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 : [0, 104, 115]


Threading read: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560, length: 75, allowing for 4 max mismatches.
Read SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 seq GGCATCTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115] positions:  [0,nodeEnd:127,readEnd:51] [104,nodeEnd:34,readEnd:62] [115,nodeEnd:36,readEnd:75] , trimmed to: [0, 104, 115]
Threaded Read as: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 : [0, 104, 115]
ReadPath@Init: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 : [0, 104, 115]


Threading read: SRR039231.11984981_FC42DB6AAXX:2:66:1684:1562, length: 51, allowing for 3 max mismatches.
Read SRR039231.11984981_FC42DB6AAXX:2:66:1684:1562 seq CTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104] positions:  [0,nodeEnd:127,readEnd:46] [104,nodeEnd:28,readEnd:51] , trimmed to: [0, 104]
Threaded Read as: SRR039231.11984981_FC42DB6AAXX:2:66:1684:1562 : [0, 104]
ReadPath@Init: SRR039231.11984981_FC42DB6AAXX:2:66:1684:1562 : [0, 104]


Threading read: SRR039231.8928386_FC42DB6AAXX:2:49:1340:1691, length: 75, allowing for 4 max mismatches.
Read SRR039231.8928386_FC42DB6AAXX:2:49:1340:1691 seq CTGGTACATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:46] [104,nodeEnd:34,readEnd:57] [115,nodeEnd:36,readEnd:70] [128,nodeEnd:28,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.8928386_FC42DB6AAXX:2:49:1340:1691 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.8928386_FC42DB6AAXX:2:49:1340:1691 : [0, 104, 115, 128]


Threading read: SRR039231.2140780_FC42DB6AAXX:2:12:746:731, length: 75, allowing for 4 max mismatches.
Read SRR039231.2140780_FC42DB6AAXX:2:12:746:731 seq ATTTCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:39] [104,nodeEnd:34,readEnd:50] [115,nodeEnd:36,readEnd:63] [128,nodeEnd:35,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.2140780_FC42DB6AAXX:2:12:746:731 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.2140780_FC42DB6AAXX:2:12:746:731 : [0, 104, 115, 128]


Threading read: SRR039231.21001541_FC42DB6AAXX:2:116:708:497, length: 75, allowing for 4 max mismatches.
Read SRR039231.21001541_FC42DB6AAXX:2:116:708:497 seq TCATGGCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:36] [104,nodeEnd:34,readEnd:47] [115,nodeEnd:36,readEnd:60] [128,nodeEnd:38,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.21001541_FC42DB6AAXX:2:116:708:497 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.21001541_FC42DB6AAXX:2:116:708:497 : [0, 104, 115, 128]


Threading read: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110, length: 70, allowing for 4 max mismatches.
Read SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 seq GAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:26] [104,nodeEnd:34,readEnd:37] [115,nodeEnd:36,readEnd:50] [128,nodeEnd:43,readEnd:70] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 : [0, 104, 115, 128]


Threading read: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536, length: 75, allowing for 4 max mismatches.
-running Needleman-Wunsch alignment of vertex to read
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh construct
INFO: Started...
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh construct
INFO: Finished.
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh traceback
INFO: Started...
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh traceback
INFO: Finished.
Vertex             1 TCAGAACAGTCATTGATATTCTTT     24
                     .||||||||||||:||||||||||
Read               1 CCAGAACAGTCATNGATATTCTTT     24


Read SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 seq GCTGAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATNGATATTCTTTATAAGCATATTCAAGCGCAC threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:31] [104,nodeEnd:34,readEnd:42] [115,nodeEnd:36,readEnd:55] [128,nodeEnd:43,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 : [0, 104, 115, 128]


Threading read: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35, length: 75, allowing for 4 max mismatches.
Read SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 seq GAGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:28] [104,nodeEnd:34,readEnd:39] [115,nodeEnd:36,readEnd:52] [128,nodeEnd:46,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 : [0, 104, 115, 128]


Threading read: SRR039231.142909_FC42DB6AAXX:2:1:1346:135, length: 75, allowing for 4 max mismatches.
Read SRR039231.142909_FC42DB6AAXX:2:1:1346:135 seq AGAAAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:27] [104,nodeEnd:34,readEnd:38] [115,nodeEnd:36,readEnd:51] [128,nodeEnd:47,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.142909_FC42DB6AAXX:2:1:1346:135 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.142909_FC42DB6AAXX:2:1:1346:135 : [0, 104, 115, 128]


Threading read: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560, length: 75, allowing for 4 max mismatches.
Read SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 seq GAAAACATTTTTGGTGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [361, 115, 128] positions:  [361,nodeEnd:47,readEnd:37] [115,nodeEnd:36,readEnd:50] [128,nodeEnd:48,readEnd:75] , trimmed to: [361, 115, 128]
Threaded Read as: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 : [361, 115, 128]
ReadPath@Init: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 : [361, 115, 128]


Threading read: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968, length: 75, allowing for 4 max mismatches.
-running Needleman-Wunsch alignment of vertex to read
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh construct
INFO: Started...
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh construct
INFO: Finished.
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh traceback
INFO: Started...
Jul 06, 2017 5:42:26 PM jaligner.NeedlemanWunschGotoh traceback
INFO: Finished.
Vertex             1 TCAGAACAGTCATTGATATTCTTT     24
                     .|||||||||||||:|||||||||
Read               1 CCAGAACAGTCATTNATATTCTTT     24


Read SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 seq AAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTNATATTCTTTATAAGCATATTCAAGCGCACTGGAAAT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:24] [104,nodeEnd:34,readEnd:35] [115,nodeEnd:36,readEnd:48] [128,nodeEnd:50,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 : [0, 104, 115, 128]


Threading read: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288, length: 75, allowing for 4 max mismatches.
Read SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 seq AAACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [0, 104, 115, 128] positions:  [0,nodeEnd:127,readEnd:24] [104,nodeEnd:34,readEnd:35] [115,nodeEnd:36,readEnd:48] [128,nodeEnd:50,readEnd:75] , trimmed to: [0, 104, 115, 128]
Threaded Read as: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 : [0, 104, 115, 128]
ReadPath@Init: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 : [0, 104, 115, 128]


Threading read: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867, length: 75, allowing for 4 max mismatches.
Read SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 seq AACATTTTTGATGGTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [104, 115, 128] positions:  [104,nodeEnd:34,readEnd:34] [115,nodeEnd:36,readEnd:47] [128,nodeEnd:51,readEnd:75] , trimmed to: [104, 115, 128]
Threaded Read as: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 : [104, 115, 128]
ReadPath@Init: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 : [104, 115, 128]


Threading read: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457, length: 75, allowing for 4 max mismatches.
Read SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 seq TTTTGATGGTTTGATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:42] [128,nodeEnd:56,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 : [337, 128]
ReadPath@Init: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 : [337, 128]


Threading read: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450, length: 67, allowing for 4 max mismatches.
Read SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 seq TTTGATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:33] [128,nodeEnd:57,readEnd:67] , trimmed to: [337, 128]
Threaded Read as: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 : [337, 128]
ReadPath@Init: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 : [337, 128]


Threading read: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595, length: 75, allowing for 4 max mismatches.
Read SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 seq TTTGATGGTTTGATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:41] [128,nodeEnd:57,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 : [337, 128]
ReadPath@Init: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 : [337, 128]


Threading read: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566, length: 58, allowing for 3 max mismatches.
Read SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 seq CCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:24] [128,nodeEnd:57,readEnd:58] , trimmed to: [115, 128]
Threaded Read as: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 : [115, 128]
ReadPath@Init: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 : [115, 128]


Threading read: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333, length: 60, allowing for 3 max mismatches.
Read SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 seq CCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:24] [128,nodeEnd:59,readEnd:60] , trimmed to: [115, 128]
Threaded Read as: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 : [115, 128]
ReadPath@Init: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 : [115, 128]


Threading read: SRR039231.390226_FC42DB6AAXX:2:3:125:1502, length: 75, allowing for 4 max mismatches.
Read SRR039231.390226_FC42DB6AAXX:2:3:125:1502 seq GGTTTGATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:35] [128,nodeEnd:63,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.390226_FC42DB6AAXX:2:3:125:1502 : [337, 128]
ReadPath@Init: SRR039231.390226_FC42DB6AAXX:2:3:125:1502 : [337, 128]


Threading read: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312, length: 75, allowing for 4 max mismatches.
Read SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 seq GTTTGATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:34] [128,nodeEnd:64,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 : [337, 128]
ReadPath@Init: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 : [337, 128]


Threading read: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958, length: 75, allowing for 4 max mismatches.
Read SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 seq GTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:34] [128,nodeEnd:64,readEnd:75] , trimmed to: [115, 128]
Threaded Read as: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 : [115, 128]
ReadPath@Init: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 : [115, 128]


Threading read: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254, length: 75, allowing for 4 max mismatches.
Read SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 seq GTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:34] [128,nodeEnd:64,readEnd:75] , trimmed to: [115, 128]
Threaded Read as: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 : [115, 128]
ReadPath@Init: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 : [115, 128]


Threading read: SRR039231.8633607_FC42DB6AAXX:2:48:203:527, length: 75, allowing for 4 max mismatches.
Read SRR039231.8633607_FC42DB6AAXX:2:48:203:527 seq GTTTGATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:34] [128,nodeEnd:64,readEnd:75] , trimmed to: [115, 128]
Threaded Read as: SRR039231.8633607_FC42DB6AAXX:2:48:203:527 : [115, 128]
ReadPath@Init: SRR039231.8633607_FC42DB6AAXX:2:48:203:527 : [115, 128]


Threading read: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161, length: 75, allowing for 4 max mismatches.
Read SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 seq ATGAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:29] [128,nodeEnd:69,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 : [337, 128]
ReadPath@Init: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 : [337, 128]


Threading read: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289, length: 66, allowing for 4 max mismatches.
Read SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 seq ATGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:29] [128,nodeEnd:60,readEnd:66] , trimmed to: [115, 128]
Threaded Read as: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 : [115, 128]
ReadPath@Init: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 : [115, 128]


Threading read: SRR039231.14735089_FC42DB6AAXX:2:82:509:413, length: 75, allowing for 4 max mismatches.
Read SRR039231.14735089_FC42DB6AAXX:2:82:509:413 seq TGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:28] [128,nodeEnd:70,readEnd:75] , trimmed to: [115, 128]
Threaded Read as: SRR039231.14735089_FC42DB6AAXX:2:82:509:413 : [115, 128]
ReadPath@Init: SRR039231.14735089_FC42DB6AAXX:2:82:509:413 : [115, 128]


Threading read: SRR039231.17788793_FC42DB6AAXX:2:98:1726:769, length: 65, allowing for 4 max mismatches.
Read SRR039231.17788793_FC42DB6AAXX:2:98:1726:769 seq CAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:70,readEnd:65] , trimmed to: [128]
Threaded Read as: SRR039231.17788793_FC42DB6AAXX:2:98:1726:769 : [128]
ReadPath@Init: SRR039231.17788793_FC42DB6AAXX:2:98:1726:769 : [128]


Threading read: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35, length: 69, allowing for 4 max mismatches.
Read SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 seq AGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:70,readEnd:69] , trimmed to: [128]
Threaded Read as: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 : [128]
ReadPath@Init: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 : [128]


Threading read: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375, length: 75, allowing for 4 max mismatches.
Read SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 seq TGAACCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:28] [128,nodeEnd:70,readEnd:75] , trimmed to: [115, 128]
Threaded Read as: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 : [115, 128]
ReadPath@Init: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 : [115, 128]


Threading read: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604, length: 72, allowing for 4 max mismatches.
Read SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 seq CCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:24] [128,nodeEnd:71,readEnd:72] , trimmed to: [115, 128]
Threaded Read as: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 : [115, 128]
ReadPath@Init: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 : [115, 128]


Threading read: SRR039231.15246719_FC42DB6AAXX:2:85:149:1887, length: 70, allowing for 4 max mismatches.
Read SRR039231.15246719_FC42DB6AAXX:2:85:149:1887 seq AGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:71,readEnd:70] , trimmed to: [128]
Threaded Read as: SRR039231.15246719_FC42DB6AAXX:2:85:149:1887 : [128]
ReadPath@Init: SRR039231.15246719_FC42DB6AAXX:2:85:149:1887 : [128]


Threading read: SRR039231.390226_FC42DB6AAXX:2:3:125:1502, length: 75, allowing for 4 max mismatches.
Read SRR039231.390226_FC42DB6AAXX:2:3:125:1502 seq GAATCAGAACAGTCATTGATATTCTTTATAAGCATATTCAATCGCACTGGAAATGGTTTTCAGGTCATTTTCCAT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [337, 128] positions:  [337,nodeEnd:47,readEnd:27] [128,nodeEnd:71,readEnd:75] , trimmed to: [337, 128]
Threaded Read as: SRR039231.390226_FC42DB6AAXX:2:3:125:1502 : [337, 128]
ReadPath@Init: SRR039231.390226_FC42DB6AAXX:2:3:125:1502 : [337, 128]


Threading read: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968, length: 72, allowing for 4 max mismatches.
Read SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 seq CCAGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [115, 128] positions:  [115,nodeEnd:36,readEnd:24] [128,nodeEnd:71,readEnd:72] , trimmed to: [115, 128]
Threaded Read as: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 : [115, 128]
ReadPath@Init: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 : [115, 128]


Threading read: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346, length: 75, allowing for 4 max mismatches.
Read SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 seq AGAACAGTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:76,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 : [128]
ReadPath@Init: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 : [128]


Threading read: SRR039231.142909_FC42DB6AAXX:2:1:1346:135, length: 75, allowing for 4 max mismatches.
Read SRR039231.142909_FC42DB6AAXX:2:1:1346:135 seq GTCATTGATATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:82,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.142909_FC42DB6AAXX:2:1:1346:135 : [128]
ReadPath@Init: SRR039231.142909_FC42DB6AAXX:2:1:1346:135 : [128]


Threading read: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958, length: 75, allowing for 4 max mismatches.
Read SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 seq TATTCTTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:90,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 : [128]
ReadPath@Init: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 : [128]


Threading read: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312, length: 57, allowing for 3 max mismatches.
Read SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 seq CAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:91,readEnd:57] , trimmed to: [128]
Threaded Read as: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 : [128]
ReadPath@Init: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 : [128]


Threading read: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110, length: 75, allowing for 4 max mismatches.
Read SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 seq TTTATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:95,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 : [128]
ReadPath@Init: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 : [128]


Threading read: SRR039231.8633607_FC42DB6AAXX:2:48:203:527, length: 75, allowing for 4 max mismatches.
Read SRR039231.8633607_FC42DB6AAXX:2:48:203:527 seq TATAAGCATATTCAAGCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:97,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.8633607_FC42DB6AAXX:2:48:203:527 : [128]
ReadPath@Init: SRR039231.8633607_FC42DB6AAXX:2:48:203:527 : [128]


Threading read: SRR039231.21670612_FC42DB6AAXX:2:119:1723:1158, length: 64, allowing for 4 max mismatches.
Read SRR039231.21670612_FC42DB6AAXX:2:119:1723:1158 seq AATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:111,readEnd:64] , trimmed to: [128]
Threaded Read as: SRR039231.21670612_FC42DB6AAXX:2:119:1723:1158 : [128]
ReadPath@Init: SRR039231.21670612_FC42DB6AAXX:2:119:1723:1158 : [128]


Threading read: SRR039231.10910792_FC42DB6AAXX:2:60:1619:404, length: 75, allowing for 4 max mismatches.
Read SRR039231.10910792_FC42DB6AAXX:2:60:1619:404 seq GCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:112,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.10910792_FC42DB6AAXX:2:60:1619:404 : [128]
ReadPath@Init: SRR039231.10910792_FC42DB6AAXX:2:60:1619:404 : [128]


Threading read: SRR039231.16895577_FC42DB6AAXX:2:94:163:51, length: 75, allowing for 4 max mismatches.
Read SRR039231.16895577_FC42DB6AAXX:2:94:163:51 seq GCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:112,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.16895577_FC42DB6AAXX:2:94:163:51 : [128]
ReadPath@Init: SRR039231.16895577_FC42DB6AAXX:2:94:163:51 : [128]


Threading read: SRR039231.3014932_FC42DB6AAXX:2:17:237:179, length: 75, allowing for 4 max mismatches.
Read SRR039231.3014932_FC42DB6AAXX:2:17:237:179 seq GCGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:112,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.3014932_FC42DB6AAXX:2:17:237:179 : [128]
ReadPath@Init: SRR039231.3014932_FC42DB6AAXX:2:17:237:179 : [128]


Threading read: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782, length: 75, allowing for 4 max mismatches.
Read SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 seq CGCACTGGAAATGGTTTTCAGGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:113,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 : [128]
ReadPath@Init: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 : [128]


Threading read: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065, length: 75, allowing for 4 max mismatches.
Read SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 seq GGTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:133,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 : [128]
ReadPath@Init: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 : [128]


Threading read: SRR039231.21734868_FC42DB6AAXX:2:120:549:795, length: 75, allowing for 4 max mismatches.
Read SRR039231.21734868_FC42DB6AAXX:2:120:549:795 seq GTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:134,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.21734868_FC42DB6AAXX:2:120:549:795 : [128]
ReadPath@Init: SRR039231.21734868_FC42DB6AAXX:2:120:549:795 : [128]


Threading read: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782, length: 75, allowing for 4 max mismatches.
Read SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 seq GTCATTTTCCATACTCTTTGCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:134,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 : [128]
ReadPath@Init: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 : [128]


Threading read: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880, length: 74, allowing for 4 max mismatches.
Read SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:152,readEnd:74] , trimmed to: [128]
Threaded Read as: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 : [128]
ReadPath@Init: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 : [128]


Threading read: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996, length: 74, allowing for 4 max mismatches.
Read SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:152,readEnd:74] , trimmed to: [128]
Threaded Read as: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 : [128]
ReadPath@Init: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 : [128]


Threading read: SRR039231.15839695_FC42DB6AAXX:2:88:581:1670, length: 75, allowing for 4 max mismatches.
Read SRR039231.15839695_FC42DB6AAXX:2:88:581:1670 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:153,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.15839695_FC42DB6AAXX:2:88:581:1670 : [128]
ReadPath@Init: SRR039231.15839695_FC42DB6AAXX:2:88:581:1670 : [128]


Threading read: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397, length: 70, allowing for 4 max mismatches.
Read SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 seq GTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:153,readEnd:70] , trimmed to: [128]
Threaded Read as: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 : [128]
ReadPath@Init: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 : [128]


Threading read: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147, length: 75, allowing for 4 max mismatches.
Read SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:153,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 : [128]
ReadPath@Init: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 : [128]


Threading read: SRR039231.624520_FC42DB6AAXX:2:4:581:550, length: 75, allowing for 4 max mismatches.
Read SRR039231.624520_FC42DB6AAXX:2:4:581:550 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:153,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.624520_FC42DB6AAXX:2:4:581:550 : [128]
ReadPath@Init: SRR039231.624520_FC42DB6AAXX:2:4:581:550 : [128]


Threading read: SRR039231.939493_FC42DB6AAXX:2:5:1771:471, length: 75, allowing for 4 max mismatches.
Read SRR039231.939493_FC42DB6AAXX:2:5:1771:471 seq GCCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:153,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.939493_FC42DB6AAXX:2:5:1771:471 : [128]
ReadPath@Init: SRR039231.939493_FC42DB6AAXX:2:5:1771:471 : [128]


Threading read: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734, length: 65, allowing for 4 max mismatches.
Read SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 seq GACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:154,readEnd:65] , trimmed to: [128]
Threaded Read as: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 : [128]
ReadPath@Init: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 : [128]


Threading read: SRR039231.16173078_FC42DB6AAXX:2:90:254:422, length: 75, allowing for 4 max mismatches.
Read SRR039231.16173078_FC42DB6AAXX:2:90:254:422 seq CCCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:154,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.16173078_FC42DB6AAXX:2:90:254:422 : [128]
ReadPath@Init: SRR039231.16173078_FC42DB6AAXX:2:90:254:422 : [128]


Threading read: SRR039231.14510947_FC42DB6AAXX:2:81:84:1895, length: 75, allowing for 4 max mismatches.
Read SRR039231.14510947_FC42DB6AAXX:2:81:84:1895 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.14510947_FC42DB6AAXX:2:81:84:1895 : [128]
ReadPath@Init: SRR039231.14510947_FC42DB6AAXX:2:81:84:1895 : [128]


Threading read: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229, length: 67, allowing for 4 max mismatches.
Read SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 seq CGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:67] , trimmed to: [128]
Threaded Read as: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 : [128]
ReadPath@Init: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 : [128]


Threading read: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281, length: 75, allowing for 4 max mismatches.
Read SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 : [128]
ReadPath@Init: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 : [128]


Threading read: SRR039231.17068078_FC42DB6AAXX:2:95:58:257, length: 75, allowing for 4 max mismatches.
Read SRR039231.17068078_FC42DB6AAXX:2:95:58:257 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.17068078_FC42DB6AAXX:2:95:58:257 : [128]
ReadPath@Init: SRR039231.17068078_FC42DB6AAXX:2:95:58:257 : [128]


Threading read: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670, length: 75, allowing for 4 max mismatches.
Read SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 : [128]
ReadPath@Init: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 : [128]


Threading read: SRR039231.4096942_FC42DB6AAXX:2:22:1764:1073, length: 75, allowing for 4 max mismatches.
Read SRR039231.4096942_FC42DB6AAXX:2:22:1764:1073 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.4096942_FC42DB6AAXX:2:22:1764:1073 : [128]
ReadPath@Init: SRR039231.4096942_FC42DB6AAXX:2:22:1764:1073 : [128]


Threading read: SRR039231.9196619_FC42DB6AAXX:2:51:473:936, length: 75, allowing for 4 max mismatches.
Read SRR039231.9196619_FC42DB6AAXX:2:51:473:936 seq CCAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:155,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.9196619_FC42DB6AAXX:2:51:473:936 : [128]
ReadPath@Init: SRR039231.9196619_FC42DB6AAXX:2:51:473:936 : [128]


Threading read: SRR039231.1328085_FC42DB6AAXX:2:8:132:68, length: 75, allowing for 4 max mismatches.
Read SRR039231.1328085_FC42DB6AAXX:2:8:132:68 seq CAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:156,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.1328085_FC42DB6AAXX:2:8:132:68 : [128]
ReadPath@Init: SRR039231.1328085_FC42DB6AAXX:2:8:132:68 : [128]


Threading read: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591, length: 75, allowing for 4 max mismatches.
Read SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 seq CAGTTTTCGACATCTCCTATTTCTTNGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGC threaded as: PATH_N_MM_COUNT: mismatches=1, path= [128] positions:  [128,nodeEnd:156,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 : [128]
ReadPath@Init: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 : [128]


Threading read: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689, length: 75, allowing for 4 max mismatches.
Read SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 seq CAGTTTTCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:156,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 : [128]
ReadPath@Init: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 : [128]


Threading read: SRR039231.3014932_FC42DB6AAXX:2:17:237:179, length: 75, allowing for 4 max mismatches.
Read SRR039231.3014932_FC42DB6AAXX:2:17:237:179 seq TCGACATCTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:162,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.3014932_FC42DB6AAXX:2:17:237:179 : [128]
ReadPath@Init: SRR039231.3014932_FC42DB6AAXX:2:17:237:179 : [128]


Threading read: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859, length: 75, allowing for 4 max mismatches.
Read SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 seq CTCCTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:169,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 : [128]
ReadPath@Init: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 : [128]


Threading read: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065, length: 39, allowing for 2 max mismatches.
Read SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 seq AAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:170,readEnd:39] , trimmed to: [128]
Threaded Read as: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 : [128]
ReadPath@Init: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 : [128]


Threading read: SRR039231.5836358_FC42DB6AAXX:2:32:993:352, length: 75, allowing for 4 max mismatches.
Read SRR039231.5836358_FC42DB6AAXX:2:32:993:352 seq CTATTTCTTTGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:172,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.5836358_FC42DB6AAXX:2:32:993:352 : [128]
ReadPath@Init: SRR039231.5836358_FC42DB6AAXX:2:32:993:352 : [128]


Threading read: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689, length: 75, allowing for 4 max mismatches.
Read SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 seq TGAGAGCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:181,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 : [128]
ReadPath@Init: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 : [128]


Threading read: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723, length: 72, allowing for 4 max mismatches.
Read SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 seq GCTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:183,readEnd:72] , trimmed to: [128]
Threaded Read as: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 : [128]
ReadPath@Init: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 : [128]


Threading read: SRR039231.19933512_FC42DB6AAXX:2:110:1189:2021, length: 71, allowing for 4 max mismatches.
Read SRR039231.19933512_FC42DB6AAXX:2:110:1189:2021 seq CATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGGTTAGCAAAAGTAAGGGCACTTTGATGGAGT threaded as: PATH_N_MM_COUNT: mismatches=1, path= [128] positions:  [128,nodeEnd:186,readEnd:71] , trimmed to: [128]
Threaded Read as: SRR039231.19933512_FC42DB6AAXX:2:110:1189:2021 : [128]
ReadPath@Init: SRR039231.19933512_FC42DB6AAXX:2:110:1189:2021 : [128]


Threading read: SRR039231.7673168_FC42DB6AAXX:2:42:1340:391, length: 75, allowing for 4 max mismatches.
Read SRR039231.7673168_FC42DB6AAXX:2:42:1340:391 seq CTCCATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:187,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.7673168_FC42DB6AAXX:2:42:1340:391 : [128]
ReadPath@Init: SRR039231.7673168_FC42DB6AAXX:2:42:1340:391 : [128]


Threading read: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880, length: 66, allowing for 4 max mismatches.
Read SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 seq TTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAAC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:189,readEnd:66] , trimmed to: [128]
Threaded Read as: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 : [128]
ReadPath@Init: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 : [128]


Threading read: SRR039231.15313573_FC42DB6AAXX:2:85:806:1481, length: 75, allowing for 4 max mismatches.
Read SRR039231.15313573_FC42DB6AAXX:2:85:806:1481 seq CATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:190,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.15313573_FC42DB6AAXX:2:85:806:1481 : [128]
ReadPath@Init: SRR039231.15313573_FC42DB6AAXX:2:85:806:1481 : [128]


Threading read: SRR039231.939493_FC42DB6AAXX:2:5:1771:471, length: 75, allowing for 4 max mismatches.
Read SRR039231.939493_FC42DB6AAXX:2:5:1771:471 seq CATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:190,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.939493_FC42DB6AAXX:2:5:1771:471 : [128]
ReadPath@Init: SRR039231.939493_FC42DB6AAXX:2:5:1771:471 : [128]


Threading read: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099, length: 75, allowing for 4 max mismatches.
Read SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 seq ATTAAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:191,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 : [128]
ReadPath@Init: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 : [128]


Threading read: SRR039231.1328085_FC42DB6AAXX:2:8:132:68, length: 46, allowing for 3 max mismatches.
Read SRR039231.1328085_FC42DB6AAXX:2:8:132:68 seq CAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:173,readEnd:46] , trimmed to: [128]
Threaded Read as: SRR039231.1328085_FC42DB6AAXX:2:8:132:68 : [128]
ReadPath@Init: SRR039231.1328085_FC42DB6AAXX:2:8:132:68 : [128]


Threading read: SRR039231.17068078_FC42DB6AAXX:2:95:58:257, length: 75, allowing for 4 max mismatches.
Read SRR039231.17068078_FC42DB6AAXX:2:95:58:257 seq AAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:194,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.17068078_FC42DB6AAXX:2:95:58:257 : [128]
ReadPath@Init: SRR039231.17068078_FC42DB6AAXX:2:95:58:257 : [128]


Threading read: SRR039231.21734868_FC42DB6AAXX:2:120:549:795, length: 75, allowing for 4 max mismatches.
Read SRR039231.21734868_FC42DB6AAXX:2:120:549:795 seq AAAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:194,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.21734868_FC42DB6AAXX:2:120:549:795 : [128]
ReadPath@Init: SRR039231.21734868_FC42DB6AAXX:2:120:549:795 : [128]


Threading read: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734, length: 75, allowing for 4 max mismatches.
Read SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 seq AAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:195,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 : [128]
ReadPath@Init: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 : [128]


Threading read: SRR039231.16173078_FC42DB6AAXX:2:90:254:422, length: 75, allowing for 4 max mismatches.
Read SRR039231.16173078_FC42DB6AAXX:2:90:254:422 seq AAATTATCAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:195,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.16173078_FC42DB6AAXX:2:90:254:422 : [128]
ReadPath@Init: SRR039231.16173078_FC42DB6AAXX:2:90:254:422 : [128]


Threading read: SRR039231.624520_FC42DB6AAXX:2:4:581:550, length: 68, allowing for 4 max mismatches.
Read SRR039231.624520_FC42DB6AAXX:2:4:581:550 seq CAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:195,readEnd:68] , trimmed to: [128]
Threaded Read as: SRR039231.624520_FC42DB6AAXX:2:4:581:550 : [128]
ReadPath@Init: SRR039231.624520_FC42DB6AAXX:2:4:581:550 : [128]


Threading read: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397, length: 66, allowing for 4 max mismatches.
Read SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 seq GGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:199,readEnd:66] , trimmed to: [128]
Threaded Read as: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 : [128]
ReadPath@Init: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 : [128]


Threading read: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147, length: 74, allowing for 4 max mismatches.
Read SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 seq CAACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:201,readEnd:74] , trimmed to: [128]
Threaded Read as: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 : [128]
ReadPath@Init: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 : [128]


Threading read: SRR039231.9196619_FC42DB6AAXX:2:51:473:936, length: 68, allowing for 4 max mismatches.
Read SRR039231.9196619_FC42DB6AAXX:2:51:473:936 seq GGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCA threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:201,readEnd:68] , trimmed to: [128]
Threaded Read as: SRR039231.9196619_FC42DB6AAXX:2:51:473:936 : [128]
ReadPath@Init: SRR039231.9196619_FC42DB6AAXX:2:51:473:936 : [128]


Threading read: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281, length: 75, allowing for 4 max mismatches.
Read SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 seq AACAAGGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:203,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 : [128]
ReadPath@Init: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 : [128]


Threading read: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996, length: 71, allowing for 4 max mismatches.
Read SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 seq GGGAGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:204,readEnd:71] , trimmed to: [128]
Threaded Read as: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 : [128]
ReadPath@Init: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 : [128]


Threading read: SRR039231.11705473_FC42DB6AAXX:2:65:662:1592, length: 65, allowing for 4 max mismatches.
Read SRR039231.11705473_FC42DB6AAXX:2:65:662:1592 seq CATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:206,readEnd:65] , trimmed to: [128]
Threaded Read as: SRR039231.11705473_FC42DB6AAXX:2:65:662:1592 : [128]
ReadPath@Init: SRR039231.11705473_FC42DB6AAXX:2:65:662:1592 : [128]


Threading read: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670, length: 75, allowing for 4 max mismatches.
Read SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 seq AGAGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:211,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 : [128]
ReadPath@Init: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 : [128]


Threading read: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229, length: 75, allowing for 4 max mismatches.
Read SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 seq AGCCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:213,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 : [128]
ReadPath@Init: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 : [128]


Threading read: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859, length: 75, allowing for 4 max mismatches.
Read SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 seq CCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:215,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 : [128]
ReadPath@Init: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 : [128]


Threading read: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591, length: 74, allowing for 4 max mismatches.
Read SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 seq CCATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:214,readEnd:74] , trimmed to: [128]
Threaded Read as: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 : [128]
ReadPath@Init: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 : [128]


Threading read: SRR039231.18088731_FC42DB6AAXX:2:100:1090:1499, length: 75, allowing for 4 max mismatches.
Read SRR039231.18088731_FC42DB6AAXX:2:100:1090:1499 seq ATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTGAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:217,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.18088731_FC42DB6AAXX:2:100:1090:1499 : [128]
ReadPath@Init: SRR039231.18088731_FC42DB6AAXX:2:100:1090:1499 : [128]


Threading read: SRR039231.5836358_FC42DB6AAXX:2:32:993:352, length: 75, allowing for 4 max mismatches.
Read SRR039231.5836358_FC42DB6AAXX:2:32:993:352 seq ATTGTTGAGTCTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTGAT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:217,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.5836358_FC42DB6AAXX:2:32:993:352 : [128]
ReadPath@Init: SRR039231.5836358_FC42DB6AAXX:2:32:993:352 : [128]


Threading read: SRR039231.19344867_FC42DB6AAXX:2:107:840:1473, length: 70, allowing for 4 max mismatches.
Read SRR039231.19344867_FC42DB6AAXX:2:107:840:1473 seq GTTGAGTCTGCTTAGCAAAAGTAAGAGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [128] positions:  [128,nodeEnd:215,readEnd:70] , trimmed to: [128]
Threaded Read as: SRR039231.19344867_FC42DB6AAXX:2:107:840:1473 : [128]
ReadPath@Init: SRR039231.19344867_FC42DB6AAXX:2:107:840:1473 : [128]


Threading read: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099, length: 75, allowing for 4 max mismatches.
Read SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 seq CTGCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTGATTCAAATATGC threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:227,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 : [128]
ReadPath@Init: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 : [128]


Threading read: SRR039231.1908187_FC42DB6AAXX:2:11:306:275, length: 75, allowing for 4 max mismatches.
Read SRR039231.1908187_FC42DB6AAXX:2:11:306:275 seq GCTTAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTGATTCAAATATGCTT threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:229,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.1908187_FC42DB6AAXX:2:11:306:275 : [128]
ReadPath@Init: SRR039231.1908187_FC42DB6AAXX:2:11:306:275 : [128]


Threading read: SRR039231.8543228_FC42DB6AAXX:2:47:1078:711, length: 72, allowing for 4 max mismatches.
Read SRR039231.8543228_FC42DB6AAXX:2:47:1078:711 seq AGCAAAAGTAAGGGCACTTTGATGGATTAACTTTGCTTCTGCATCCAGTCGCTTTTGATTCAAATATGCTTG threaded as: PATH_N_MM_COUNT: mismatches=1, path= [128] positions:  [128,nodeEnd:230,readEnd:72] , trimmed to: [128]
Threaded Read as: SRR039231.8543228_FC42DB6AAXX:2:47:1078:711 : [128]
ReadPath@Init: SRR039231.8543228_FC42DB6AAXX:2:47:1078:711 : [128]


Threading read: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723, length: 75, allowing for 4 max mismatches.
Read SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 seq TAGCAAAAGTAAGGGCACTTTGATGGAGTAACTTTGCTTCTGCATCCAGTCGCTTTTGATTCAAATATGCTTGTG threaded as: PATH_N_MM_COUNT: mismatches=0, path= [128] positions:  [128,nodeEnd:232,readEnd:75] , trimmed to: [128]
Threaded Read as: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 : [128]
ReadPath@Init: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 : [128]
number of reads found = 163 (from total of 163) which came from 96 pairs
Read name to pairing info: SRR039231.3927545_FC42DB6AAXX:2:22:138:1536 => [0][0, 104, 115, 128]
Read name to pairing info: SRR039231.19866284_FC42DB6AAXX:2:110:546:1457 => [0, 337][337, 128]
Read name to pairing info: SRR039231.21734868_FC42DB6AAXX:2:120:549:795 => [128][128]
Read name to pairing info: SRR039231.5836358_FC42DB6AAXX:2:32:993:352 => [128][128]
Read name to pairing info: SRR039231.10363944_FC42DB6AAXX:2:57:1495:794 => [0][0]
Read name to pairing info: SRR039231.6565424_FC42DB6AAXX:2:36:1061:969 => [0][0]
Read name to pairing info: SRR039231.6669437_FC42DB6AAXX:2:37:324:1344 => [0]
Read name to pairing info: SRR039231.7136667_FC42DB6AAXX:2:39:1376:566 => [0][115, 128]
Read name to pairing info: SRR039231.19933512_FC42DB6AAXX:2:110:1189:2021 => [128]
Read name to pairing info: SRR039231.21001541_FC42DB6AAXX:2:116:708:497 => [0, 104, 115][0, 104, 115, 128]
Read name to pairing info: SRR039231.21589259_FC42DB6AAXX:2:119:947:546 => [0]
Read name to pairing info: SRR039231.6179653_FC42DB6AAXX:2:34:822:1560 => [0, 104, 115][361, 115, 128]
Read name to pairing info: SRR039231.21382512_FC42DB6AAXX:2:118:769:1375 => [0, 104, 115][115, 128]
Read name to pairing info: SRR039231.18110959_FC42DB6AAXX:2:100:1305:958 => [115, 128][128]
Read name to pairing info: SRR039231.2762040_FC42DB6AAXX:2:15:1357:1099 => [128][128]
Read name to pairing info: SRR039231.10188932_FC42DB6AAXX:2:56:1521:723 => [128][128]
Read name to pairing info: SRR039231.17068078_FC42DB6AAXX:2:95:58:257 => [128][128]
Read name to pairing info: SRR039231.1282721_FC42DB6AAXX:2:7:1475:1500 => [0]
Read name to pairing info: SRR039231.21670612_FC42DB6AAXX:2:119:1723:1158 => [128]
Read name to pairing info: SRR039231.21078379_FC42DB6AAXX:2:116:1435:1547 => [0][0, 104]
Read name to pairing info: SRR039231.14173065_FC42DB6AAXX:2:79:322:765 => [0]
Read name to pairing info: SRR039231.13719753_FC42DB6AAXX:2:76:1191:1256 => [0][0, 104]
Read name to pairing info: SRR039231.11705473_FC42DB6AAXX:2:65:662:1592 => [128]
Read name to pairing info: SRR039231.5230525_FC42DB6AAXX:2:29:349:1587 => [0][0, 104]
Read name to pairing info: SRR039231.10910792_FC42DB6AAXX:2:60:1619:404 => [128]
Read name to pairing info: SRR039231.1328085_FC42DB6AAXX:2:8:132:68 => [128][128]
Read name to pairing info: SRR039231.15839695_FC42DB6AAXX:2:88:581:1670 => [128]
Read name to pairing info: SRR039231.624520_FC42DB6AAXX:2:4:581:550 => [128][128]
Read name to pairing info: SRR039231.4096942_FC42DB6AAXX:2:22:1764:1073 => [128]
Read name to pairing info: SRR039231.7894225_FC42DB6AAXX:2:43:1741:968 => [0, 104, 115, 128][115, 128]
Read name to pairing info: SRR039231.892387_FC42DB6AAXX:2:5:1324:1026 => [0]
Read name to pairing info: SRR039231.19732435_FC42DB6AAXX:2:109:1038:1442 => [0]
Read name to pairing info: SRR039231.9625434_FC42DB6AAXX:2:53:1210:1288 => [0, 104][0, 104, 115, 128]
Read name to pairing info: SRR039231.13728972_FC42DB6AAXX:2:76:1282:833 => [0][0, 104, 115]
Read name to pairing info: SRR039231.1908187_FC42DB6AAXX:2:11:306:275 => [128]
Read name to pairing info: SRR039231.15919613_FC42DB6AAXX:2:88:1358:281 => [128][128]
Read name to pairing info: SRR039231.17788793_FC42DB6AAXX:2:98:1726:769 => [128]
Read name to pairing info: SRR039231.21446475_FC42DB6AAXX:2:118:1372:1867 => [0][104, 115, 128]
Read name to pairing info: SRR039231.13264799_FC42DB6AAXX:2:74:237:1090 => [0][0, 337]
Read name to pairing info: SRR039231.14396657_FC42DB6AAXX:2:80:740:1859 => [128][128]
Read name to pairing info: SRR039231.20711733_FC42DB6AAXX:2:114:1506:133 => [0][0, 337]
Read name to pairing info: SRR039231.2103331_FC42DB6AAXX:2:12:391:1567 => [0]
Read name to pairing info: SRR039231.17582312_FC42DB6AAXX:2:97:1496:2016 => [0][0, 104]
Read name to pairing info: SRR039231.15246719_FC42DB6AAXX:2:85:149:1887 => [128]
Read name to pairing info: SRR039231.15270417_FC42DB6AAXX:2:85:381:1158 => [0][0, 104]
Read name to pairing info: SRR039231.5174963_FC42DB6AAXX:2:28:1572:254 => [0, 104, 115][115, 128]
Read name to pairing info: SRR039231.13448095_FC42DB6AAXX:2:75:280:1746 => [0]
Read name to pairing info: SRR039231.9506053_FC42DB6AAXX:2:52:1789:1689 => [128][128]
Read name to pairing info: SRR039231.18849210_FC42DB6AAXX:2:104:1359:1828 => [0]
Read name to pairing info: SRR039231.21527302_FC42DB6AAXX:2:119:363:1289 => [0, 104][115, 128]
Read name to pairing info: SRR039231.390226_FC42DB6AAXX:2:3:125:1502 => [337, 128][337, 128]
Read name to pairing info: SRR039231.12346824_FC42DB6AAXX:2:68:1758:1346 => [0, 104, 115][128]
Read name to pairing info: SRR039231.142909_FC42DB6AAXX:2:1:1346:135 => [0, 104, 115, 128][128]
Read name to pairing info: SRR039231.7673168_FC42DB6AAXX:2:42:1340:391 => [128]
Read name to pairing info: SRR039231.16147670_FC42DB6AAXX:2:90:3:1638 => [0][0, 337]
Read name to pairing info: SRR039231.5093995_FC42DB6AAXX:2:28:781:1782 => [128][128]
Read name to pairing info: SRR039231.16895577_FC42DB6AAXX:2:94:163:51 => [128]
Read name to pairing info: SRR039231.19344867_FC42DB6AAXX:2:107:840:1473 => [128]
Read name to pairing info: SRR039231.14487335_FC42DB6AAXX:2:80:1636:450 => [0, 337][337, 128]
Read name to pairing info: SRR039231.1666142_FC42DB6AAXX:2:9:1550:312 => [337, 128][128]
Read name to pairing info: SRR039231.8543228_FC42DB6AAXX:2:47:1078:711 => [128]
Read name to pairing info: SRR039231.12658759_FC42DB6AAXX:2:70:1304:1333 => [0, 104][115, 128]
Read name to pairing info: SRR039231.8633607_FC42DB6AAXX:2:48:203:527 => [115, 128][128]
Read name to pairing info: SRR039231.18088731_FC42DB6AAXX:2:100:1090:1499 => [128]
Read name to pairing info: SRR039231.14043245_FC42DB6AAXX:2:78:825:704 => [0]
Read name to pairing info: SRR039231.11984981_FC42DB6AAXX:2:66:1684:1562 => [0, 104]
Read name to pairing info: SRR039231.15313573_FC42DB6AAXX:2:85:806:1481 => [128]
Read name to pairing info: SRR039231.8928386_FC42DB6AAXX:2:49:1340:1691 => [0, 104, 115, 128]
Read name to pairing info: SRR039231.12877170_FC42DB6AAXX:2:71:1700:1065 => [128][128]
Read name to pairing info: SRR039231.1580103_FC42DB6AAXX:2:9:737:1229 => [128][128]
Read name to pairing info: SRR039231.2140780_FC42DB6AAXX:2:12:746:731 => [0][0, 104, 115, 128]
Read name to pairing info: SRR039231.15920717_FC42DB6AAXX:2:88:1368:397 => [128][128]
Read name to pairing info: SRR039231.15012333_FC42DB6AAXX:2:83:1432:595 => [0, 337][337, 128]
Read name to pairing info: SRR039231.18386017_FC42DB6AAXX:2:102:421:1161 => [0, 337][337, 128]
Read name to pairing info: SRR039231.10679582_FC42DB6AAXX:2:59:1098:1734 => [128][128]
Read name to pairing info: SRR039231.14510947_FC42DB6AAXX:2:81:84:1895 => [128]
Read name to pairing info: SRR039231.2284997_FC42DB6AAXX:2:13:349:1110 => [0, 104, 115, 128][128]
Read name to pairing info: SRR039231.939493_FC42DB6AAXX:2:5:1771:471 => [128][128]
Read name to pairing info: SRR039231.17587629_FC42DB6AAXX:2:97:1549:1670 => [128][128]
Read name to pairing info: SRR039231.238223_FC42DB6AAXX:2:2:467:595 => [0][0]
Read name to pairing info: SRR039231.13481733_FC42DB6AAXX:2:75:614:1615 => [0][0]
Read name to pairing info: SRR039231.14735089_FC42DB6AAXX:2:82:509:413 => [0, 104, 115][115, 128]
Read name to pairing info: SRR039231.16902890_FC42DB6AAXX:2:94:234:1996 => [128][128]
Read name to pairing info: SRR039231.14481949_FC42DB6AAXX:2:80:1583:1278 => [0][0]
Read name to pairing info: SRR039231.9196619_FC42DB6AAXX:2:51:473:936 => [128][128]
Read name to pairing info: SRR039231.16173078_FC42DB6AAXX:2:90:254:422 => [128][128]
Read name to pairing info: SRR039231.13707404_FC42DB6AAXX:2:76:1069:604 => [0, 104][115, 128]
Read name to pairing info: SRR039231.10010027_FC42DB6AAXX:2:55:1503:1027 => [0][0]
Read name to pairing info: SRR039231.20146338_FC42DB6AAXX:2:111:1444:35 => [0, 104, 115, 128][128]
Read name to pairing info: SRR039231.20100594_FC42DB6AAXX:2:111:1008:1849 => [0][0, 104]
Read name to pairing info: SRR039231.3014932_FC42DB6AAXX:2:17:237:179 => [128][128]
Read name to pairing info: SRR039231.21829784_FC42DB6AAXX:2:120:1439:177 => [0][0, 104, 115]
Read name to pairing info: SRR039231.13009251_FC42DB6AAXX:2:72:1245:1880 => [128][128]
Read name to pairing info: SRR039231.5276511_FC42DB6AAXX:2:29:797:1951 => [0]
Read name to pairing info: SRR039231.17800444_FC42DB6AAXX:2:99:56:1147 => [128][128]
Read name to pairing info: SRR039231.6233377_FC42DB6AAXX:2:34:1346:591 => [128][128]

SECTION
==================
Pairing up the reads into PairPaths
===========================

we have 1 reads supporting the path: PairPath [_paths=[[0], [0, 104, 115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 337], [337, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 2 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115], [0, 104, 115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115], [361, 115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115], [115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[115, 128], [128]]]
we have 3 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 4 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 5 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 2 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 3 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 6 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 7 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115, 128], [115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104], [0, 104, 115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [0, 104, 115]]]
we have 8 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [104, 115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0], [0, 337]]]
we have 9 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0], [0, 337]]]
we have 4 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 5 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 2 reads supporting the path: PairPath [_paths=[[0, 104, 115], [115, 128]]]
we have 10 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104], [115, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[337, 128], [337, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115], [128]]]
we have 1 reads supporting the path: PairPath [_paths=[[0, 104, 115, 128], [128]]]
we have 3 reads supporting the path: PairPath [_paths=[[0], [0, 337]]]
we have 11 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0, 337], [337, 128]]]
we have 1 reads supporting the path: PairPath [_paths=[[337, 128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0, 104], [115, 128]]]
we have 2 reads supporting the path: PairPath [_paths=[[115, 128], [128]]]
we have 12 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 13 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0], [0, 104, 115, 128]]]
we have 14 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 3 reads supporting the path: PairPath [_paths=[[0, 337], [337, 128]]]
we have 4 reads supporting the path: PairPath [_paths=[[0, 337], [337, 128]]]
we have 15 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0, 104, 115, 128], [128]]]
we have 16 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 17 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 3 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 4 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 3 reads supporting the path: PairPath [_paths=[[0, 104, 115], [115, 128]]]
we have 18 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 5 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 19 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 20 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 3 reads supporting the path: PairPath [_paths=[[0, 104], [115, 128]]]
we have 6 reads supporting the path: PairPath [_paths=[[0], [0]]]
we have 3 reads supporting the path: PairPath [_paths=[[0, 104, 115, 128], [128]]]
we have 6 reads supporting the path: PairPath [_paths=[[0], [0, 104]]]
we have 21 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 2 reads supporting the path: PairPath [_paths=[[0], [0, 104, 115]]]
we have 22 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 23 reads supporting the path: PairPath [_paths=[[128], [128]]]
we have 24 reads supporting the path: PairPath [_paths=[[128], [128]]]
number of reads used = 96
## Read PathPair results: 29 singletons,  num pairs: 67, num pairs discarded: 0
Printing Pair Paths  Before DAG Overlap Layout ------------------
Start Vertex:0
PairPaths@Init: PairPath [_paths=[[0], [0]]]=6
PairPaths@Init: PairPath [_paths=[[0], []]]=11
PairPaths@Init: PairPath [_paths=[[0, 104], [115, 128]]]=3
PairPaths@Init: PairPath [_paths=[[0], [0, 104]]]=6
PairPaths@Init: PairPath [_paths=[[0, 104, 115], [115, 128]]]=3
PairPaths@Init: PairPath [_paths=[[0], [0, 104, 115]]]=2
PairPaths@Init: PairPath [_paths=[[0, 104, 115, 128], [128]]]=3
PairPaths@Init: PairPath [_paths=[[0, 104, 115, 128], []]]=1
PairPaths@Init: PairPath [_paths=[[0], [115, 128]]]=1
PairPaths@Init: PairPath [_paths=[[0, 104, 115], [0, 104, 115, 128]]]=1
PairPaths@Init: PairPath [_paths=[[0], [0, 337]]]=3
PairPaths@Init: PairPath [_paths=[[0], [104, 115, 128]]]=1
PairPaths@Init: PairPath [_paths=[[0], [0, 104, 115, 128]]]=2
PairPaths@Init: PairPath [_paths=[[0, 104], []]]=1
PairPaths@Init: PairPath [_paths=[[0, 104, 115], [128]]]=1
PairPaths@Init: PairPath [_paths=[[0, 104, 115, 128], [115, 128]]]=1
PairPaths@Init: PairPath [_paths=[[0, 104], [0, 104, 115, 128]]]=1
PairPaths@Init: PairPath [_paths=[[0, 337], [337, 128]]]=4
PairPaths@Init: PairPath [_paths=[[0, 104, 115], [361, 115, 128]]]=1
Start Vertex:128
PairPaths@Init: PairPath [_paths=[[128], [128]]]=24
PairPaths@Init: PairPath [_paths=[[128], []]]=16
Start Vertex:337
PairPaths@Init: PairPath [_paths=[[337, 128], [337, 128]]]=1
PairPaths@Init: PairPath [_paths=[[337, 128], [128]]]=1
Start Vertex:115
PairPaths@Init: PairPath [_paths=[[115, 128], [128]]]=2
SECTION
========  Create DAG from Overlap Layout ============


Noncontained paths: [[0, 104, 115, 128], [361, 115, 128], [337, 128], [0, 337]]
Node[128] has repeat count: 3
Node[0] has repeat count: 2
Node[337] has repeat count: 2
Node[115] has repeat count: 2
Node[104] has repeat count: 1
Node[361] has repeat count: 1
path PN1::[0, 104, 115, 128] extends no path
path PN2::[361, 115, 128] extends no path
PathNode Overlap Detected: [overlap:  1] PN4::[0, 337] extended by PN3::[337, 128]
extension of: PN4::[0, 337] by PN3::[337, 128] has 1 terminal matches.
path PN4::[0, 337] extends no path
PathNodeDescription: PN3::[337, 128]
PathNodeDescription: PN4::[0, 337]
PathNodeDescription: PN1::[0, 104, 115, 128]
PathNodeDescription: PN2::[361, 115, 128]
// Breaking cycles in Path Overlap Graph (POG), Round: 1
SECTION
========  Convert Path-DAG to SeqVertex-DAG ============


prep_for_DAG_collapse: PN3 CurrVert:[385, 386], OrigVert:[337, 128]
prep_for_DAG_collapse: PN4 CurrVert:[387, 388], OrigVert:[0, 337]
prep_for_DAG_collapse: PN1 CurrVert:[389, 390, 391, 392], OrigVert:[0, 104, 115, 128]
prep_for_DAG_collapse: PN2 CurrVert:[393, 394, 395], OrigVert:[361, 115, 128]

DFS_path_to_graph: targeting: PN4::[0, 337]

DFS_path_to_graph: targeting: PN3::[337, 128]

DFS_path_to_graph: targeting: PN1::[0, 104, 115, 128]

DFS_path_to_graph: targeting: PN2::[361, 115, 128]


## Round: 1 Zipping up.
## zip_up()
attempt_zip_merge_SeqVertices([AACATTTTTG...GATATTCTTT:W5(V385_337_D0), TCAGAACAGTCATTGATATTCTTT:W5(V388_337_D4)])
UpZipMerging nodes: [AACATTTTTG...GATATTCTTT:W5(V385_337_D0), AACATTTTTG...GATATTCTTT:W5(V388_337_D4)] to TCAGAACAGTCATTGATATTCTTT:W5(V396_337_D0)
Zip up merged: 2 nodes.


## Round: 2 Zipping up.
Zip up merged: 0 nodes.


## Round: 3 Zipping down.
Zip down merged: 0 nodes.


## Round: 4 Zipping up.
Zip up merged: 0 nodes.


## Round: 5 Zipping down.
Zip down merged: 0 nodes.
Old_to_new_vertex_id_mapping: 387 => 387 (stays same)
Old_to_new_vertex_id_mapping: 389 => 389 (stays same)
Old_to_new_vertex_id_mapping: 393 => 393 (stays same)
Old_to_new_vertex_id_mapping: 385 => 396
Old_to_new_vertex_id_mapping: 388 => 396
Old_to_new_vertex_id_mapping: 390 => 390 (stays same)
Old_to_new_vertex_id_mapping: 394 => 394 (stays same)
Old_to_new_vertex_id_mapping: 386 => 386 (stays same)
Old_to_new_vertex_id_mapping: 391 => 391 (stays same)
Old_to_new_vertex_id_mapping: 395 => 395 (stays same)
Old_to_new_vertex_id_mapping: 392 => 392 (stays same)
Old-to-new-path mappings: {[337, 128]=[396, 386], [361, 115, 128]=[393, 394, 395], [0, 337]=[387, 396], [0, 104, 115, 128]=[389, 390, 391, 392]}
LONG_READ_PATH_MAP is:{}
LONG_READ_NAME_TO_PPath is : {}
LONG_READ_PATH_MAP updated to:{}
LONG_READ_NAME_TO_PPath updated to : {}
Printing Pair Paths ------------------
Start Vertex:386
PairPaths@PostOverlapLayout: PairPath [_paths=[[386], [386]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[386], []]]=16
PairPaths@PostOverlapLayout: PairPath [_paths=[[386], [392]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[386], [395]]]=24
Start Vertex:387
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [394, 395]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [387]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [389, 390]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [389]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [390, 391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [389, 390, 391, 392]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [389, 390, 391]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], [387, 396]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[387, 396], [396, 386]]]=4
PairPaths@PostOverlapLayout: PairPath [_paths=[[387], []]]=11
Start Vertex:389
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [395]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [390, 391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390], [394, 395]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], [391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390], [389, 390, 391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], [386]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [393, 394, 395]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [389, 390, 391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [394, 395]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [389, 390]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [387]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [391, 392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [389]]]=6
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390], [391, 392]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [387, 396]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [389, 390, 391]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], [394, 395]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], []]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], [392]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391, 392], [395]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [391, 392]]]=3
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390, 391], [386]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389, 390], []]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [389, 390, 391, 392]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], []]]=11
PairPaths@PostOverlapLayout: PairPath [_paths=[[389], [394, 395]]]=1
Start Vertex:391
PairPaths@PostOverlapLayout: PairPath [_paths=[[391, 392], [392]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[391, 392], [386]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[391, 392], [395]]]=2
Start Vertex:392
PairPaths@PostOverlapLayout: PairPath [_paths=[[392], [392]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[392], [395]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[392], []]]=16
PairPaths@PostOverlapLayout: PairPath [_paths=[[392], [386]]]=24
Start Vertex:394
PairPaths@PostOverlapLayout: PairPath [_paths=[[394, 395], [392]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[394, 395], [386]]]=2
PairPaths@PostOverlapLayout: PairPath [_paths=[[394, 395], [395]]]=2
Start Vertex:395
PairPaths@PostOverlapLayout: PairPath [_paths=[[395], [395]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[395], [386]]]=24
PairPaths@PostOverlapLayout: PairPath [_paths=[[395], []]]=16
PairPaths@PostOverlapLayout: PairPath [_paths=[[395], [392]]]=24
Start Vertex:396
PairPaths@PostOverlapLayout: PairPath [_paths=[[396, 386], [395]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[396, 386], [392]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[396, 386], [396, 386]]]=1
PairPaths@PostOverlapLayout: PairPath [_paths=[[396, 386], [386]]]=1
SECTION
======= Reorganize Read Pairings =========


NODE_DESCR: ATAAGCATAT...TATGCTTGTG:W20(V386_128_D2) Preds: [TCAGAACAGTCATTGATATTCTTT:W5(V396_337_D1) ] Succ: []
NODE_DESCR: TAAAGGGGAT...GTTTGATGAA:W21(V387_0_D0) Preds: [] Succ: [TCAGAACAGTCATTGATATTCTTT:W5(V396_337_D1) ]
NODE_DESCR: TAAAGGGGAT...GTTTGATGAA:W21(V389_0_D0) Preds: [] Succ: [CCAGAACAGTC:W21(V390_104_D1) ]
NODE_DESCR: CCAGAACAGTC:W21(V390_104_D1) Preds: [TAAAGGGGAT...GTTTGATGAA:W21(V389_0_D0) ] Succ: [ATTGATATTCTTT:W17(V391_115_D2) ]
NODE_DESCR: ATTGATATTCTTT:W17(V391_115_D2) Preds: [CCAGAACAGTC:W21(V390_104_D1) ] Succ: [ATAAGCATAT...TATGCTTGTG:W20(V392_128_D3) ]
NODE_DESCR: ATAAGCATAT...TATGCTTGTG:W20(V392_128_D3) Preds: [ATTGATATTCTTT:W17(V391_115_D2) ] Succ: []
NODE_DESCR: TCATGGCTGA...CAGAACAGTC:W2(V393_361_D0) Preds: [] Succ: [ATTGATATTCTTT:W17(V394_115_D1) ]
NODE_DESCR: ATTGATATTCTTT:W17(V394_115_D1) Preds: [TCATGGCTGA...CAGAACAGTC:W2(V393_361_D0) ] Succ: [ATAAGCATAT...TATGCTTGTG:W20(V395_128_D2) ]
NODE_DESCR: ATAAGCATAT...TATGCTTGTG:W20(V395_128_D2) Preds: [ATTGATATTCTTT:W17(V394_115_D1) ] Succ: []
NODE_DESCR: TCAGAACAGTCATTGATATTCTTT:W5(V396_337_D1) Preds: [TAAAGGGGAT...GTTTGATGAA:W21(V387_0_D0) ] Succ: [ATAAGCATAT...TATGCTTGTG:W20(V386_128_D2) ]
combinePaths: [386], [386]
we have 24 reads supporting the path: PairPath [_paths=[[386], []]]
OK pp update to new DAG: PairPath [_paths=[[386], [386]]] => PairPath [_paths=[[386], []]]
we have 40 reads supporting the path: PairPath [_paths=[[386], []]]
combinePaths: [386], [392]
we have 64 reads supporting the path: PairPath [_paths=[[386], []]]
we have 24 reads supporting the path: PairPath [_paths=[[392], []]]
Warning... pp: PairPath [_paths=[[386], [392]]] needed to be split into: PairPath [_paths=[[386], []]] and PairPath [_paths=[[392], []]]
combinePaths: [386], [395]
we have 88 reads supporting the path: PairPath [_paths=[[386], []]]
we have 24 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[386], [395]]] needed to be split into: PairPath [_paths=[[386], []]] and PairPath [_paths=[[395], []]]
combinePaths: [387], [394, 395]
we have 1 reads supporting the path: PairPath [_paths=[[387], []]]
we have 1 reads supporting the path: PairPath [_paths=[[394, 395], []]]
Warning... pp: PairPath [_paths=[[387], [394, 395]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[394, 395], []]]
combinePaths: [387], [387]
we have 7 reads supporting the path: PairPath [_paths=[[387], []]]
OK pp update to new DAG: PairPath [_paths=[[387], [387]]] => PairPath [_paths=[[387], []]]
combinePaths: [387], [391, 392]
we have 8 reads supporting the path: PairPath [_paths=[[387], []]]
we have 1 reads supporting the path: PairPath [_paths=[[391, 392], []]]
Warning... pp: PairPath [_paths=[[387], [391, 392]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[391, 392], []]]
combinePaths: [387], [389, 390]
we have 14 reads supporting the path: PairPath [_paths=[[387], []]]
we have 6 reads supporting the path: PairPath [_paths=[[389, 390], []]]
Warning... pp: PairPath [_paths=[[387], [389, 390]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[389, 390], []]]
combinePaths: [387], [389]
we have 20 reads supporting the path: PairPath [_paths=[[387], []]]
we have 6 reads supporting the path: PairPath [_paths=[[389], []]]
Warning... pp: PairPath [_paths=[[387], [389]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[389], []]]
combinePaths: [387], [390, 391, 392]
we have 21 reads supporting the path: PairPath [_paths=[[387], []]]
we have 1 reads supporting the path: PairPath [_paths=[[390, 391, 392], []]]
Warning... pp: PairPath [_paths=[[387], [390, 391, 392]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[390, 391, 392], []]]
combinePaths: [387], [389, 390, 391, 392]
we have 23 reads supporting the path: PairPath [_paths=[[387], []]]
we have 2 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
Warning... pp: PairPath [_paths=[[387], [389, 390, 391, 392]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [387], [389, 390, 391]
we have 25 reads supporting the path: PairPath [_paths=[[387], []]]
we have 2 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
Warning... pp: PairPath [_paths=[[387], [389, 390, 391]]] needed to be split into: PairPath [_paths=[[387], []]] and PairPath [_paths=[[389, 390, 391], []]]
combinePaths: [387], [387, 396]
we have 3 reads supporting the path: PairPath [_paths=[[387, 396], []]]
OK pp update to new DAG: PairPath [_paths=[[387], [387, 396]]] => PairPath [_paths=[[387, 396], []]]
combinePaths: [387, 396], [396, 386]
we have 4 reads supporting the path: PairPath [_paths=[[387, 396, 386], []]]
OK pp update to new DAG: PairPath [_paths=[[387, 396], [396, 386]]] => PairPath [_paths=[[387, 396, 386], []]]
we have 36 reads supporting the path: PairPath [_paths=[[387], []]]
combinePaths: [389, 390, 391], [395]
we have 3 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
we have 25 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391], [395]]] needed to be split into: PairPath [_paths=[[389, 390, 391], []]] and PairPath [_paths=[[395], []]]
combinePaths: [389], [390, 391, 392]
Could Impute path connectingPairPath [_paths=[[389], [390, 391, 392]]] containing intervening nodes: []
we have 3 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [390, 391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391], [392]
Could Impute path connectingPairPath [_paths=[[389, 390, 391], [392]]] containing intervening nodes: []
we have 4 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390, 391], [392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390], [394, 395]
we have 9 reads supporting the path: PairPath [_paths=[[389, 390], []]]
we have 4 reads supporting the path: PairPath [_paths=[[394, 395], []]]
Warning... pp: PairPath [_paths=[[389, 390], [394, 395]]] needed to be split into: PairPath [_paths=[[389, 390], []]] and PairPath [_paths=[[394, 395], []]]
combinePaths: [389, 390, 391, 392], [391, 392]
we have 5 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390, 391, 392], [391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390], [389, 390, 391, 392]
we have 6 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390], [389, 390, 391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391, 392], [386]
we have 9 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
we have 91 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391, 392], [386]]] needed to be split into: PairPath [_paths=[[389, 390, 391, 392], []]] and PairPath [_paths=[[386], []]]
combinePaths: [389, 390, 391], [393, 394, 395]
we have 4 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
we have 1 reads supporting the path: PairPath [_paths=[[393, 394, 395], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391], [393, 394, 395]]] needed to be split into: PairPath [_paths=[[389, 390, 391], []]] and PairPath [_paths=[[393, 394, 395], []]]
combinePaths: [389, 390, 391], [389, 390, 391, 392]
we have 10 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390, 391], [389, 390, 391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391], [394, 395]
we have 7 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
we have 7 reads supporting the path: PairPath [_paths=[[394, 395], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391], [394, 395]]] needed to be split into: PairPath [_paths=[[389, 390, 391], []]] and PairPath [_paths=[[394, 395], []]]
combinePaths: [389], [389, 390]
we have 15 reads supporting the path: PairPath [_paths=[[389, 390], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [389, 390]]] => PairPath [_paths=[[389, 390], []]]
combinePaths: [389], [387]
we have 12 reads supporting the path: PairPath [_paths=[[389], []]]
we have 42 reads supporting the path: PairPath [_paths=[[387], []]]
Warning... pp: PairPath [_paths=[[389], [387]]] needed to be split into: PairPath [_paths=[[389], []]] and PairPath [_paths=[[387], []]]
combinePaths: [389], [391, 392]
Could Impute path connectingPairPath [_paths=[[389], [391, 392]]] containing intervening nodes: [390]
we have 11 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389], [389]
we have 18 reads supporting the path: PairPath [_paths=[[389], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [389]]] => PairPath [_paths=[[389], []]]
combinePaths: [389, 390], [391, 392]
Could Impute path connectingPairPath [_paths=[[389, 390], [391, 392]]] containing intervening nodes: []
we have 14 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390], [391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389], [387, 396]
we have 21 reads supporting the path: PairPath [_paths=[[389], []]]
we have 6 reads supporting the path: PairPath [_paths=[[387, 396], []]]
Warning... pp: PairPath [_paths=[[389], [387, 396]]] needed to be split into: PairPath [_paths=[[389], []]] and PairPath [_paths=[[387, 396], []]]
combinePaths: [389], [389, 390, 391]
we have 9 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [389, 390, 391]]] => PairPath [_paths=[[389, 390, 391], []]]
combinePaths: [389, 390, 391, 392], [394, 395]
we have 15 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
we have 8 reads supporting the path: PairPath [_paths=[[394, 395], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391, 392], [394, 395]]] needed to be split into: PairPath [_paths=[[389, 390, 391, 392], []]] and PairPath [_paths=[[394, 395], []]]
we have 16 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391, 392], [392]
we have 19 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390, 391, 392], [392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391, 392], [395]
we have 22 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
we have 28 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391, 392], [395]]] needed to be split into: PairPath [_paths=[[389, 390, 391, 392], []]] and PairPath [_paths=[[395], []]]
combinePaths: [389, 390, 391], [391, 392]
we have 25 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389, 390, 391], [391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
combinePaths: [389, 390, 391], [386]
we have 10 reads supporting the path: PairPath [_paths=[[389, 390, 391], []]]
we have 92 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[389, 390, 391], [386]]] needed to be split into: PairPath [_paths=[[389, 390, 391], []]] and PairPath [_paths=[[386], []]]
we have 16 reads supporting the path: PairPath [_paths=[[389, 390], []]]
combinePaths: [389], [389, 390, 391, 392]
we have 27 reads supporting the path: PairPath [_paths=[[389, 390, 391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[389], [389, 390, 391, 392]]] => PairPath [_paths=[[389, 390, 391, 392], []]]
we have 32 reads supporting the path: PairPath [_paths=[[389], []]]
combinePaths: [389], [394, 395]
we have 33 reads supporting the path: PairPath [_paths=[[389], []]]
we have 9 reads supporting the path: PairPath [_paths=[[394, 395], []]]
Warning... pp: PairPath [_paths=[[389], [394, 395]]] needed to be split into: PairPath [_paths=[[389], []]] and PairPath [_paths=[[394, 395], []]]
combinePaths: [391, 392], [392]
we have 3 reads supporting the path: PairPath [_paths=[[391, 392], []]]
OK pp update to new DAG: PairPath [_paths=[[391, 392], [392]]] => PairPath [_paths=[[391, 392], []]]
combinePaths: [391, 392], [386]
we have 5 reads supporting the path: PairPath [_paths=[[391, 392], []]]
we have 94 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[391, 392], [386]]] needed to be split into: PairPath [_paths=[[391, 392], []]] and PairPath [_paths=[[386], []]]
combinePaths: [391, 392], [395]
we have 7 reads supporting the path: PairPath [_paths=[[391, 392], []]]
we have 30 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[391, 392], [395]]] needed to be split into: PairPath [_paths=[[391, 392], []]] and PairPath [_paths=[[395], []]]
combinePaths: [392], [392]
we have 48 reads supporting the path: PairPath [_paths=[[392], []]]
OK pp update to new DAG: PairPath [_paths=[[392], [392]]] => PairPath [_paths=[[392], []]]
combinePaths: [392], [395]
we have 72 reads supporting the path: PairPath [_paths=[[392], []]]
we have 54 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[392], [395]]] needed to be split into: PairPath [_paths=[[392], []]] and PairPath [_paths=[[395], []]]
we have 88 reads supporting the path: PairPath [_paths=[[392], []]]
combinePaths: [392], [386]
we have 112 reads supporting the path: PairPath [_paths=[[392], []]]
we have 118 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[392], [386]]] needed to be split into: PairPath [_paths=[[392], []]] and PairPath [_paths=[[386], []]]
combinePaths: [394, 395], [392]
we have 11 reads supporting the path: PairPath [_paths=[[394, 395], []]]
we have 114 reads supporting the path: PairPath [_paths=[[392], []]]
Warning... pp: PairPath [_paths=[[394, 395], [392]]] needed to be split into: PairPath [_paths=[[394, 395], []]] and PairPath [_paths=[[392], []]]
combinePaths: [394, 395], [386]
we have 13 reads supporting the path: PairPath [_paths=[[394, 395], []]]
we have 120 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[394, 395], [386]]] needed to be split into: PairPath [_paths=[[394, 395], []]] and PairPath [_paths=[[386], []]]
combinePaths: [394, 395], [395]
we have 15 reads supporting the path: PairPath [_paths=[[394, 395], []]]
OK pp update to new DAG: PairPath [_paths=[[394, 395], [395]]] => PairPath [_paths=[[394, 395], []]]
combinePaths: [395], [395]
we have 78 reads supporting the path: PairPath [_paths=[[395], []]]
OK pp update to new DAG: PairPath [_paths=[[395], [395]]] => PairPath [_paths=[[395], []]]
combinePaths: [395], [386]
we have 102 reads supporting the path: PairPath [_paths=[[395], []]]
we have 144 reads supporting the path: PairPath [_paths=[[386], []]]
Warning... pp: PairPath [_paths=[[395], [386]]] needed to be split into: PairPath [_paths=[[395], []]] and PairPath [_paths=[[386], []]]
we have 118 reads supporting the path: PairPath [_paths=[[395], []]]
combinePaths: [395], [392]
we have 142 reads supporting the path: PairPath [_paths=[[395], []]]
we have 138 reads supporting the path: PairPath [_paths=[[392], []]]
Warning... pp: PairPath [_paths=[[395], [392]]] needed to be split into: PairPath [_paths=[[395], []]] and PairPath [_paths=[[392], []]]
combinePaths: [396, 386], [395]
we have 1 reads supporting the path: PairPath [_paths=[[396, 386], []]]
we have 143 reads supporting the path: PairPath [_paths=[[395], []]]
Warning... pp: PairPath [_paths=[[396, 386], [395]]] needed to be split into: PairPath [_paths=[[396, 386], []]] and PairPath [_paths=[[395], []]]
combinePaths: [396, 386], [392]
we have 2 reads supporting the path: PairPath [_paths=[[396, 386], []]]
we have 139 reads supporting the path: PairPath [_paths=[[392], []]]
Warning... pp: PairPath [_paths=[[396, 386], [392]]] needed to be split into: PairPath [_paths=[[396, 386], []]] and PairPath [_paths=[[392], []]]
combinePaths: [396, 386], [396, 386]
we have 3 reads supporting the path: PairPath [_paths=[[396, 386], []]]
OK pp update to new DAG: PairPath [_paths=[[396, 386], [396, 386]]] => PairPath [_paths=[[396, 386], []]]
combinePaths: [396, 386], [386]
we have 4 reads supporting the path: PairPath [_paths=[[396, 386], []]]
OK pp update to new DAG: PairPath [_paths=[[396, 386], [386]]] => PairPath [_paths=[[396, 386], []]]
Start Vertex:386
PairPaths@AfterPairReorganization: PairPath [_paths=[[386], []]]=144
Start Vertex:387
PairPaths@AfterPairReorganization: PairPath [_paths=[[387, 396], []]]=6
PairPaths@AfterPairReorganization: PairPath [_paths=[[387, 396, 386], []]]=4
PairPaths@AfterPairReorganization: PairPath [_paths=[[387], []]]=42
Start Vertex:389
PairPaths@AfterPairReorganization: PairPath [_paths=[[389, 390, 391], []]]=10
PairPaths@AfterPairReorganization: PairPath [_paths=[[389, 390], []]]=16
PairPaths@AfterPairReorganization: PairPath [_paths=[[389, 390, 391, 392], []]]=27
PairPaths@AfterPairReorganization: PairPath [_paths=[[389], []]]=33
Start Vertex:390
PairPaths@AfterPairReorganization: PairPath [_paths=[[390, 391, 392], []]]=1
Start Vertex:391
PairPaths@AfterPairReorganization: PairPath [_paths=[[391, 392], []]]=7
Start Vertex:392
PairPaths@AfterPairReorganization: PairPath [_paths=[[392], []]]=139
Start Vertex:393
PairPaths@AfterPairReorganization: PairPath [_paths=[[393, 394, 395], []]]=1
Start Vertex:394
PairPaths@AfterPairReorganization: PairPath [_paths=[[394, 395], []]]=15
Start Vertex:395
PairPaths@AfterPairReorganization: PairPath [_paths=[[395], []]]=143
Start Vertex:396
PairPaths@AfterPairReorganization: PairPath [_paths=[[396, 386], []]]=4

ComponentDivision: 0 contains the following vertices:
node_id: 386
node_id: 387
node_id: 396

ComponentDivision: 1 contains the following vertices:
node_id: 389
node_id: 390
node_id: 391
node_id: 392

ComponentDivision: 2 contains the following vertices:
node_id: 393
node_id: 394
node_id: 395
total number of components = 3
Searching for kmer set: CCAGAACAGTCATTGATATTCTTT -> CAGAACAGTCATTGATATTCTTTA
Searching for kmer set: AAACATTTTTGATGGTTTGATGAA -> AACATTTTTGATGGTTTGATGAAC
Searching for kmer set: AAACATTTTTGATGGTTTGATGAA -> AACATTTTTGATGGTTTGATGAAT
Searching for kmer set: GTGGTTTGATGAACCAGAACAGTC -> TGGTTTGATGAACCAGAACAGTCA
Searching for kmer set: ATGGTTTGATGAACCAGAACAGTC -> TGGTTTGATGAACCAGAACAGTCA
Searching for kmer set: TCAGAACAGTCATTGATATTCTTT -> CAGAACAGTCATTGATATTCTTTA
Searching for kmer set: CCAGAACAGTCATTGATATTCTTT -> CAGAACAGTCATTGATATTCTTTA

SECTION
============= Begin Assembly ===============


Assembling subcomponent 0
Subcomponent: 0, adding pairpath: PairPath [_paths=[[386], []]]
Subcomponent: 0, adding pairpath: PairPath [_paths=[[387, 396], []]]
Subcomponent: 0, adding pairpath: PairPath [_paths=[[387, 396, 386], []]]
Subcomponent: 0, adding pairpath: PairPath [_paths=[[387], []]]
Subcomponent: 0, adding pairpath: PairPath [_paths=[[396, 386], []]]
####  Component Read Summary BEFORE PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 386 has size: 1
Node: 386 has 1 pairpaths stored:
	PairPath [_paths=[[386], []]] has read support: 144

componentReadHash, start node: 387 has size: 3
Node: 387 has 3 pairpaths stored:
	PairPath [_paths=[[387], []]] has read support: 42
	PairPath [_paths=[[387, 396], []]] has read support: 6
	PairPath [_paths=[[387, 396, 386], []]] has read support: 4

componentReadHash, start node: 396 has size: 1
Node: 396 has 1 pairpaths stored:
	PairPath [_paths=[[396, 386], []]] has read support: 4

## Total number of pairpaths: 5
####  Component Read Summary AFTER PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 386 has size: 1
Node: 386 has 1 pairpaths stored:
	PairPath [_paths=[[386], []]] has read support: 144

componentReadHash, start node: 387 has size: 3
Node: 387 has 3 pairpaths stored:
	PairPath [_paths=[[387], []]] has read support: 42
	PairPath [_paths=[[387, 396], []]] has read support: 6
	PairPath [_paths=[[387, 396, 386], []]] has read support: 4

componentReadHash, start node: 396 has size: 1
Node: 396 has 1 pairpaths stored:
	PairPath [_paths=[[396, 386], []]] has read support: 4

## Total number of pairpaths: 5
### Extracting triplets from reads.
Setting initial triplet adjacency_path for central node: 396 => [387, 396, 386]

### 1 nodes have locked-in triplet paths:
Triplet locks for: 396 : [[387, 396, 386]]
### Extracting complex path prefixes from reads.
-capturing path prefixes
-removing prefixes that are subpaths of other prefixes
EXTENDED_TRIPLET_CAPTURED: [387, 396, 386]

#### Extended triplets from reads: 
Complex prefix paths for: 386 : [[387, 396, 386]]

SECTION
###############
## Starting Butterfly Assembly ##
###################


PairPaths to assemble:
Start Vertex:-1
PairPaths@BflyStart: PairPath [_paths=[[-1, 387], []]]=1
Start Vertex:386
PairPaths@BflyStart: PairPath [_paths=[[386], []]]=144
PairPaths@BflyStart: PairPath [_paths=[[386, -2], []]]=1
Start Vertex:387
PairPaths@BflyStart: PairPath [_paths=[[387, 396], []]]=6
PairPaths@BflyStart: PairPath [_paths=[[387, 396, 386], []]]=4
PairPaths@BflyStart: PairPath [_paths=[[387], []]]=42
Start Vertex:396
PairPaths@BflyStart: PairPath [_paths=[[396, 386], []]]=4
QUEUE IS: [:W2147483647(V-1_D-1)]


#### getAllProbablePaths() The next node in the queue C is -1
	butterfly pct done: 1 / 3 = 33.333336% pct done.
ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 387], []]]
Exploring extension of: 1 paths that end at vertex: -1

== Current Paths Constructed Up To Vertex: -1 :
PathPartialReconstruction@[-1] : [-1]

Adding the reads {PairPath [_paths=[[-1, 387], []]]=1} to the path [-1]


################################################
###### Exploring extension of v: -1 by successor: 387
################################################


Count of paths ending at v: -1 = 1
path_ending_at_v: [-1]


# [PathCounter(387)=0 Examining potential extension of path ending at node V: -1 by successor: 387, via path=[-1]
path [-1] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 387], []]]
-checking if subPath has enough read support. Exploring sub path: [387]
-readsOfPathUntilV: PairPath [_paths=[[-1, 387], []]]
	-checking if pp: PairPath [_paths=[[-1, 387], []]] supports extension of [-1, 387] => true
examining subPath: [387] for reinforcement by read: [[-1, 387], []] :true
the read PairPath [_paths=[[-1, 387], []]](1) enforces the sub-path ([387])
-found: 1 reads supporting subpath.
the sub-path ([387]) has PASSED

Successful extension of 387 to generate path [-1, 387]
updateReadsOfPath: [-1, 387]
read PairPath [_paths=[[-1, 387], []]] is consistent with 387
pct_contained_propagated: 0.0%
387 was added to the queue
QUEUE IS: [GAAGTTCATG...GTTTGATGAA:W21(V387_0_D0)]


#### getAllProbablePaths() The next node in the queue C is 387
	butterfly pct done: 2 / 3 = 66.66667% pct done.
ReadsStartingAtV_START_BFLY, Node: 387 read: PairPath [_paths=[[387, 396], []]]
ReadsStartingAtV_START_BFLY, Node: 387 read: PairPath [_paths=[[387, 396, 386], []]]
ReadsStartingAtV_START_BFLY, Node: 387 read: PairPath [_paths=[[387], []]]
Exploring extension of: 1 paths that end at vertex: 387

== Current Paths Constructed Up To Vertex: 387 :
PathPartialReconstruction@[387] : [-1, 387]

Adding the reads {PairPath [_paths=[[387, 396], []]]=6, PairPath [_paths=[[387, 396, 386], []]]=4, PairPath [_paths=[[387], []]]=42} to the path [-1, 387]


################################################
###### Exploring extension of v: 387 by successor: 396
################################################


Count of paths ending at v: 387 = 1
path_ending_at_v: [-1, 387]


# [PathCounter(396)=0 Examining potential extension of path ending at node V: 387 by successor: 396, via path=[-1, 387]
path [-1, 387] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1, 387]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 387], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396, 386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387], []]]
-checking if subPath has enough read support. Exploring sub path: [387, 396]
-readsOfPathUntilV: PairPath [_paths=[[387, 396], []]]
	-checking if pp: PairPath [_paths=[[387, 396], []]] supports extension of [-1, 387, 396] => true
examining subPath: [387, 396] for reinforcement by read: [[387, 396], []] :true
the read PairPath [_paths=[[387, 396], []]](6) enforces the sub-path ([387, 396])
-found: 6 reads supporting subpath.
the sub-path ([387, 396]) has PASSED

Successful extension of 396 to generate path [-1, 387, 396]
updateReadsOfPath: [-1, 387, 396]
read PairPath [_paths=[[387, 396], []]] is consistent with 396
read PairPath [_paths=[[387, 396, 386], []]] is consistent with 396
read PairPath [_paths=[[387], []]] is consistent with 396
pct_contained_propagated: 25.0%
396 was added to the queue
QUEUE IS: [TCAGAACAGTCATTGATATTCTTT:W5(V396_337_D1)]


#### getAllProbablePaths() The next node in the queue C is 396
	butterfly pct done: 3 / 3 = 100.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 396 read: PairPath [_paths=[[396, 386], []]]
Exploring extension of: 1 paths that end at vertex: 396

== Current Paths Constructed Up To Vertex: 396 :
PathPartialReconstruction@[396] : [-1, 387, 396]

Adding the reads {PairPath [_paths=[[396, 386], []]]=4} to the path [-1, 387, 396]


################################################
###### Exploring extension of v: 396 by successor: 386
################################################


Count of paths ending at v: 396 = 1
path_ending_at_v: [-1, 387, 396]


# [PathCounter(386)=0 Examining potential extension of path ending at node V: 396 by successor: 386, via path=[-1, 387, 396]
TripletMapper doesnt contain node: 396
ReadsOfPathUntilV: PATH: [-1, 387, 396]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 387], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[396, 386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396, 386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387], []]]
-checking if subPath has enough read support. Exploring sub path: [386]
-readsOfPathUntilV: PairPath [_paths=[[387, 396], []]]
	-checking if pp: PairPath [_paths=[[387, 396], []]] supports extension of [-1, 387, 396, 386] => false
examining subPath: [386] for reinforcement by read: [[387, 396], []] :false
the read PairPath [_paths=[[387, 396], []]](6) does not enforce the sub-path ([386])
-readsOfPathUntilV: PairPath [_paths=[[-1, 387], []]]
	-checking if pp: PairPath [_paths=[[-1, 387], []]] supports extension of [-1, 387, 396, 386] => false
examining subPath: [386] for reinforcement by read: [[-1, 387], []] :false
the read PairPath [_paths=[[-1, 387], []]](1) does not enforce the sub-path ([386])
-readsOfPathUntilV: PairPath [_paths=[[396, 386], []]]
	-checking if pp: PairPath [_paths=[[396, 386], []]] supports extension of [-1, 387, 396, 386] => true
examining subPath: [386] for reinforcement by read: [[396, 386], []] :true
the read PairPath [_paths=[[396, 386], []]](4) enforces the sub-path ([386])
-found: 4 reads supporting subpath.
the sub-path ([386]) has PASSED

Successful extension of 386 to generate path [-1, 387, 396, 386]
updateReadsOfPath: [-1, 387, 396, 386]
read PairPath [_paths=[[396, 386], []]] is consistent with 386
read PairPath [_paths=[[387, 396, 386], []]] is consistent with 386
pct_contained_propagated: 60.000004%
386 was added to the queue
QUEUE IS: [ATAAGCATAT...TATGCTTGTG:W20(V386_128_D2)]


#### getAllProbablePaths() The next node in the queue C is 386
	butterfly pct done: 4 / 3 = 133.33334% pct done.
ReadsStartingAtV_START_BFLY, Node: 386 read: PairPath [_paths=[[386], []]]
ReadsStartingAtV_START_BFLY, Node: 386 read: PairPath [_paths=[[386, -2], []]]
Exploring extension of: 1 paths that end at vertex: 386

== Current Paths Constructed Up To Vertex: 386 :
PathPartialReconstruction@[386] : [-1, 387, 396, 386]

Adding the reads {PairPath [_paths=[[386], []]]=144, PairPath [_paths=[[386, -2], []]]=1} to the path [-1, 387, 396, 386]


################################################
###### Exploring extension of v: 386 by successor: -2
################################################


Count of paths ending at v: 386 = 1
path_ending_at_v: [-1, 387, 396, 386]


# [PathCounter(-2)=0 Examining potential extension of path ending at node V: 386 by successor: -2, via path=[-1, 387, 396, 386]
TripletMapper doesnt contain node: 386
ReadsOfPathUntilV: PATH: [-1, 387, 396, 386]
ReadsOfPathUntiV: READ: PairPath [_paths=[[386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[386, -2], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 387], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[396, 386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387, 396, 386], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[387], []]]
-checking if subPath has enough read support. Exploring sub path: [386, -2]
-readsOfPathUntilV: PairPath [_paths=[[386], []]]
	-checking if pp: PairPath [_paths=[[386], []]] supports extension of [-1, 387, 396, 386, -2] => false
examining subPath: [386, -2] for reinforcement by read: [[386], []] :false
the read PairPath [_paths=[[386], []]](144) does not enforce the sub-path ([386, -2])
-readsOfPathUntilV: PairPath [_paths=[[387, 396], []]]
	-checking if pp: PairPath [_paths=[[387, 396], []]] supports extension of [-1, 387, 396, 386, -2] => false
examining subPath: [386, -2] for reinforcement by read: [[387, 396], []] :false
the read PairPath [_paths=[[387, 396], []]](6) does not enforce the sub-path ([386, -2])
-readsOfPathUntilV: PairPath [_paths=[[386, -2], []]]
	-checking if pp: PairPath [_paths=[[386, -2], []]] supports extension of [-1, 387, 396, 386, -2] => true
examining subPath: [386, -2] for reinforcement by read: [[386, -2], []] :true
the read PairPath [_paths=[[386, -2], []]](1) enforces the sub-path ([386, -2])
-found: 1 reads supporting subpath.
the sub-path ([386, -2]) has PASSED

Successful extension of -2 to generate path [-1, 387, 396, 386, -2]
updateReadsOfPath: [-1, 387, 396, 386, -2]
read PairPath [_paths=[[386], []]] is consistent with -2
read PairPath [_paths=[[386, -2], []]] is consistent with -2
pct_contained_propagated: 71.42857%
-2 was added to the queue
QUEUE IS: [:W-1(V-2_D-1)]


#### getAllProbablePaths() The next node in the queue C is -2
	butterfly pct done: 5 / 3 = 166.66666% pct done.
ReadsStartingAtV_START_BFLY-2 EMPTY
Exploring extension of: 1 paths that end at vertex: -2

== Current Paths Constructed Up To Vertex: -2 :
PathPartialReconstruction@[-2] : [-1, 387, 396, 386, -2]
the finished path: [-1, 387, 396, 386, -2] was added to the final paths, with 202 support
FinalPath@BeforeFiltering: [-1, 387, 396, 386, -2]
Grouping paths into genes
IsoformClustering, number of clusters = 0
Sep Gene IDs:{[-1, 387, 396, 386, -2]=1}
FinalPath@AfterFiltering: [-1, 387, 396, 386, -2]
Final Paths: 1

Final path reported: comp0_g1_i1 len=360 path=[387:0-126 396:127-150 386:151-359] [-1, 387, 396, 386, -2]

SECTION
============= Begin Assembly ===============


Assembling subcomponent 1
Subcomponent: 1, adding pairpath: PairPath [_paths=[[389, 390, 391], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[389, 390], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[389, 390, 391, 392], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[389], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[390, 391, 392], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[391, 392], []]]
Subcomponent: 1, adding pairpath: PairPath [_paths=[[392], []]]
####  Component Read Summary BEFORE PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 389 has size: 4
Node: 389 has 4 pairpaths stored:
	PairPath [_paths=[[389], []]] has read support: 33
	PairPath [_paths=[[389, 390, 391, 392], []]] has read support: 27
	PairPath [_paths=[[389, 390], []]] has read support: 16
	PairPath [_paths=[[389, 390, 391], []]] has read support: 10

componentReadHash, start node: 390 has size: 1
Node: 390 has 1 pairpaths stored:
	PairPath [_paths=[[390, 391, 392], []]] has read support: 1

componentReadHash, start node: 391 has size: 1
Node: 391 has 1 pairpaths stored:
	PairPath [_paths=[[391, 392], []]] has read support: 7

componentReadHash, start node: 392 has size: 1
Node: 392 has 1 pairpaths stored:
	PairPath [_paths=[[392], []]] has read support: 139

## Total number of pairpaths: 7
####  Component Read Summary AFTER PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 389 has size: 4
Node: 389 has 4 pairpaths stored:
	PairPath [_paths=[[389], []]] has read support: 33
	PairPath [_paths=[[389, 390, 391, 392], []]] has read support: 27
	PairPath [_paths=[[389, 390], []]] has read support: 16
	PairPath [_paths=[[389, 390, 391], []]] has read support: 10

componentReadHash, start node: 390 has size: 1
Node: 390 has 1 pairpaths stored:
	PairPath [_paths=[[390, 391, 392], []]] has read support: 1

componentReadHash, start node: 391 has size: 1
Node: 391 has 1 pairpaths stored:
	PairPath [_paths=[[391, 392], []]] has read support: 7

componentReadHash, start node: 392 has size: 1
Node: 392 has 1 pairpaths stored:
	PairPath [_paths=[[392], []]] has read support: 139

## Total number of pairpaths: 7
### Extracting triplets from reads.
Setting initial triplet adjacency_path for central node: 390 => [389, 390, 391]
triplet adjacency_path of node: 390 => [389, 390, 391] already captured.
Setting initial triplet adjacency_path for central node: 391 => [390, 391, 392]
triplet adjacency_path of node: 391 => [390, 391, 392] already captured.

### 2 nodes have locked-in triplet paths:
Triplet locks for: 390 : [[389, 390, 391]]
Triplet locks for: 391 : [[390, 391, 392]]
### Extracting complex path prefixes from reads.
-capturing path prefixes
-removing prefixes that are subpaths of other prefixes
EXTENDED_TRIPLET_CAPTURED: [389, 390, 391]
EXTENDED_TRIPLET_CAPTURED: [389, 390, 391, 392]

#### Extended triplets from reads: 
Complex prefix paths for: 391 : [[389, 390, 391]]
Complex prefix paths for: 392 : [[389, 390, 391, 392]]

SECTION
###############
## Starting Butterfly Assembly ##
###################


PairPaths to assemble:
Start Vertex:-1
PairPaths@BflyStart: PairPath [_paths=[[-1, 389], []]]=1
Start Vertex:389
PairPaths@BflyStart: PairPath [_paths=[[389, 390, 391], []]]=10
PairPaths@BflyStart: PairPath [_paths=[[389, 390], []]]=16
PairPaths@BflyStart: PairPath [_paths=[[389, 390, 391, 392], []]]=27
PairPaths@BflyStart: PairPath [_paths=[[389], []]]=33
Start Vertex:390
PairPaths@BflyStart: PairPath [_paths=[[390, 391, 392], []]]=1
Start Vertex:391
PairPaths@BflyStart: PairPath [_paths=[[391, 392], []]]=7
Start Vertex:392
PairPaths@BflyStart: PairPath [_paths=[[392], []]]=139
PairPaths@BflyStart: PairPath [_paths=[[392, -2], []]]=1
QUEUE IS: [:W2147483647(V-1_D-1)]


#### getAllProbablePaths() The next node in the queue C is -1
	butterfly pct done: 1 / 4 = 25.0% pct done.
ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 389], []]]
Exploring extension of: 1 paths that end at vertex: -1

== Current Paths Constructed Up To Vertex: -1 :
PathPartialReconstruction@[-1] : [-1]

Adding the reads {PairPath [_paths=[[-1, 389], []]]=1} to the path [-1]


################################################
###### Exploring extension of v: -1 by successor: 387
################################################


component either lacks: 387 or at sink


################################################
###### Exploring extension of v: -1 by successor: 389
################################################


Count of paths ending at v: -1 = 1
path_ending_at_v: [-1]


# [PathCounter(389)=0 Examining potential extension of path ending at node V: -1 by successor: 389, via path=[-1]
path [-1] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 389], []]]
-checking if subPath has enough read support. Exploring sub path: [389]
-readsOfPathUntilV: PairPath [_paths=[[-1, 389], []]]
	-checking if pp: PairPath [_paths=[[-1, 389], []]] supports extension of [-1, 389] => true
examining subPath: [389] for reinforcement by read: [[-1, 389], []] :true
the read PairPath [_paths=[[-1, 389], []]](1) enforces the sub-path ([389])
-found: 1 reads supporting subpath.
the sub-path ([389]) has PASSED

Successful extension of 389 to generate path [-1, 389]
updateReadsOfPath: [-1, 389]
read PairPath [_paths=[[-1, 389], []]] is consistent with 389
pct_contained_propagated: 0.0%
389 was added to the queue
QUEUE IS: [GAAGTTCATG...GTTTGATGAA:W21(V389_0_D0)]


#### getAllProbablePaths() The next node in the queue C is 389
	butterfly pct done: 2 / 4 = 50.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 389 read: PairPath [_paths=[[389, 390, 391], []]]
ReadsStartingAtV_START_BFLY, Node: 389 read: PairPath [_paths=[[389, 390], []]]
ReadsStartingAtV_START_BFLY, Node: 389 read: PairPath [_paths=[[389, 390, 391, 392], []]]
ReadsStartingAtV_START_BFLY, Node: 389 read: PairPath [_paths=[[389], []]]
Exploring extension of: 1 paths that end at vertex: 389

== Current Paths Constructed Up To Vertex: 389 :
PathPartialReconstruction@[389] : [-1, 389]

Adding the reads {PairPath [_paths=[[389, 390, 391], []]]=10, PairPath [_paths=[[389, 390], []]]=16, PairPath [_paths=[[389, 390, 391, 392], []]]=27, PairPath [_paths=[[389], []]]=33} to the path [-1, 389]


################################################
###### Exploring extension of v: 389 by successor: 390
################################################


Count of paths ending at v: 389 = 1
path_ending_at_v: [-1, 389]


# [PathCounter(390)=0 Examining potential extension of path ending at node V: 389 by successor: 390, via path=[-1, 389]
path [-1, 389] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1, 389]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389], []]]
-checking if subPath has enough read support. Exploring sub path: [389, 390]
-readsOfPathUntilV: PairPath [_paths=[[389, 390, 391], []]]
	-checking if pp: PairPath [_paths=[[389, 390, 391], []]] supports extension of [-1, 389, 390] => true
examining subPath: [389, 390] for reinforcement by read: [[389, 390, 391], []] :true
the read PairPath [_paths=[[389, 390, 391], []]](10) enforces the sub-path ([389, 390])
-found: 10 reads supporting subpath.
the sub-path ([389, 390]) has PASSED

Successful extension of 390 to generate path [-1, 389, 390]
updateReadsOfPath: [-1, 389, 390]
read PairPath [_paths=[[389, 390, 391], []]] is consistent with 390
read PairPath [_paths=[[389, 390], []]] is consistent with 390
read PairPath [_paths=[[389, 390, 391, 392], []]] is consistent with 390
read PairPath [_paths=[[389], []]] is consistent with 390
pct_contained_propagated: 20.0%
390 was added to the queue
QUEUE IS: [CCAGAACAGTC:W21(V390_104_D1)]


#### getAllProbablePaths() The next node in the queue C is 390
	butterfly pct done: 3 / 4 = 75.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 390 read: PairPath [_paths=[[390, 391, 392], []]]
Exploring extension of: 1 paths that end at vertex: 390

== Current Paths Constructed Up To Vertex: 390 :
PathPartialReconstruction@[390] : [-1, 389, 390]

Adding the reads {PairPath [_paths=[[390, 391, 392], []]]=1} to the path [-1, 389, 390]


################################################
###### Exploring extension of v: 390 by successor: 391
################################################


Count of paths ending at v: 390 = 1
path_ending_at_v: [-1, 389, 390]


# [PathCounter(391)=0 Examining potential extension of path ending at node V: 390 by successor: 391, via path=[-1, 389, 390]
TripletMapper doesnt contain node: 390
ReadsOfPathUntilV: PATH: [-1, 389, 390]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[390, 391, 392], []]]
-checking if subPath has enough read support. Exploring sub path: [389, 390, 391]
-readsOfPathUntilV: PairPath [_paths=[[389, 390, 391], []]]
	-checking if pp: PairPath [_paths=[[389, 390, 391], []]] supports extension of [-1, 389, 390, 391] => true
examining subPath: [389, 390, 391] for reinforcement by read: [[389, 390, 391], []] :true
the read PairPath [_paths=[[389, 390, 391], []]](10) enforces the sub-path ([389, 390, 391])
-found: 10 reads supporting subpath.
the sub-path ([389, 390, 391]) has PASSED

Successful extension of 391 to generate path [-1, 389, 390, 391]
updateReadsOfPath: [-1, 389, 390, 391]
read PairPath [_paths=[[389, 390, 391], []]] is consistent with 391
read PairPath [_paths=[[389, 390, 391, 392], []]] is consistent with 391
read PairPath [_paths=[[390, 391, 392], []]] is consistent with 391
pct_contained_propagated: 50.0%
391 was added to the queue
QUEUE IS: [ATTGATATTCTTT:W17(V391_115_D2)]


#### getAllProbablePaths() The next node in the queue C is 391
	butterfly pct done: 4 / 4 = 100.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 391 read: PairPath [_paths=[[391, 392], []]]
Exploring extension of: 1 paths that end at vertex: 391

== Current Paths Constructed Up To Vertex: 391 :
PathPartialReconstruction@[391] : [-1, 389, 390, 391]

Adding the reads {PairPath [_paths=[[391, 392], []]]=7} to the path [-1, 389, 390, 391]


################################################
###### Exploring extension of v: 391 by successor: 392
################################################


Count of paths ending at v: 391 = 1
path_ending_at_v: [-1, 389, 390, 391]


# [PathCounter(392)=0 Examining potential extension of path ending at node V: 391 by successor: 392, via path=[-1, 389, 390, 391]
TripletMapper doesnt contain node: 391
ReadsOfPathUntilV: PATH: [-1, 389, 390, 391]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[390, 391, 392], []]]
-checking if subPath has enough read support. Exploring sub path: [392]
-readsOfPathUntilV: PairPath [_paths=[[389, 390, 391], []]]
	-checking if pp: PairPath [_paths=[[389, 390, 391], []]] supports extension of [-1, 389, 390, 391, 392] => false
examining subPath: [392] for reinforcement by read: [[389, 390, 391], []] :false
the read PairPath [_paths=[[389, 390, 391], []]](10) does not enforce the sub-path ([392])
-readsOfPathUntilV: PairPath [_paths=[[389, 390], []]]
	-checking if pp: PairPath [_paths=[[389, 390], []]] supports extension of [-1, 389, 390, 391, 392] => false
examining subPath: [392] for reinforcement by read: [[389, 390], []] :false
the read PairPath [_paths=[[389, 390], []]](16) does not enforce the sub-path ([392])
-readsOfPathUntilV: PairPath [_paths=[[391, 392], []]]
	-checking if pp: PairPath [_paths=[[391, 392], []]] supports extension of [-1, 389, 390, 391, 392] => true
examining subPath: [392] for reinforcement by read: [[391, 392], []] :true
the read PairPath [_paths=[[391, 392], []]](7) enforces the sub-path ([392])
-found: 7 reads supporting subpath.
the sub-path ([392]) has PASSED

Successful extension of 392 to generate path [-1, 389, 390, 391, 392]
updateReadsOfPath: [-1, 389, 390, 391, 392]
read PairPath [_paths=[[391, 392], []]] is consistent with 392
read PairPath [_paths=[[389, 390, 391, 392], []]] is consistent with 392
read PairPath [_paths=[[390, 391, 392], []]] is consistent with 392
pct_contained_propagated: 57.14286%
392 was added to the queue
QUEUE IS: [ATAAGCATAT...TATGCTTGTG:W20(V392_128_D3)]


#### getAllProbablePaths() The next node in the queue C is 392
	butterfly pct done: 5 / 4 = 125.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 392 read: PairPath [_paths=[[392], []]]
ReadsStartingAtV_START_BFLY, Node: 392 read: PairPath [_paths=[[392, -2], []]]
Exploring extension of: 1 paths that end at vertex: 392

== Current Paths Constructed Up To Vertex: 392 :
PathPartialReconstruction@[392] : [-1, 389, 390, 391, 392]

Adding the reads {PairPath [_paths=[[392], []]]=139, PairPath [_paths=[[392, -2], []]]=1} to the path [-1, 389, 390, 391, 392]


################################################
###### Exploring extension of v: 392 by successor: -2
################################################


Count of paths ending at v: 392 = 1
path_ending_at_v: [-1, 389, 390, 391, 392]


# [PathCounter(-2)=0 Examining potential extension of path ending at node V: 392 by successor: -2, via path=[-1, 389, 390, 391, 392]
TripletMapper doesnt contain node: 392
ReadsOfPathUntilV: PATH: [-1, 389, 390, 391, 392]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389, 390, 391, 392], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[392, -2], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[389], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[390, 391, 392], []]]
-checking if subPath has enough read support. Exploring sub path: [392, -2]
-readsOfPathUntilV: PairPath [_paths=[[389, 390, 391], []]]
	-checking if pp: PairPath [_paths=[[389, 390, 391], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[389, 390, 391], []] :false
the read PairPath [_paths=[[389, 390, 391], []]](10) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[389, 390], []]]
	-checking if pp: PairPath [_paths=[[389, 390], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[389, 390], []] :false
the read PairPath [_paths=[[389, 390], []]](16) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[391, 392], []]]
	-checking if pp: PairPath [_paths=[[391, 392], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[391, 392], []] :false
the read PairPath [_paths=[[391, 392], []]](7) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[-1, 389], []]]
	-checking if pp: PairPath [_paths=[[-1, 389], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[-1, 389], []] :false
the read PairPath [_paths=[[-1, 389], []]](1) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[392], []]]
	-checking if pp: PairPath [_paths=[[392], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[392], []] :false
the read PairPath [_paths=[[392], []]](139) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[389, 390, 391, 392], []]]
	-checking if pp: PairPath [_paths=[[389, 390, 391, 392], []]] supports extension of [-1, 389, 390, 391, 392, -2] => false
examining subPath: [392, -2] for reinforcement by read: [[389, 390, 391, 392], []] :false
the read PairPath [_paths=[[389, 390, 391, 392], []]](27) does not enforce the sub-path ([392, -2])
-readsOfPathUntilV: PairPath [_paths=[[392, -2], []]]
	-checking if pp: PairPath [_paths=[[392, -2], []]] supports extension of [-1, 389, 390, 391, 392, -2] => true
examining subPath: [392, -2] for reinforcement by read: [[392, -2], []] :true
the read PairPath [_paths=[[392, -2], []]](1) enforces the sub-path ([392, -2])
-found: 1 reads supporting subpath.
the sub-path ([392, -2]) has PASSED

Successful extension of -2 to generate path [-1, 389, 390, 391, 392, -2]
updateReadsOfPath: [-1, 389, 390, 391, 392, -2]
read PairPath [_paths=[[392], []]] is consistent with -2
read PairPath [_paths=[[392, -2], []]] is consistent with -2
pct_contained_propagated: 77.77778%
-2 was added to the queue
QUEUE IS: [:W-1(V-2_D-1)]


#### getAllProbablePaths() The next node in the queue C is -2
	butterfly pct done: 6 / 4 = 150.0% pct done.
ReadsStartingAtV_START_BFLY-2 EMPTY
Exploring extension of: 1 paths that end at vertex: -2

== Current Paths Constructed Up To Vertex: -2 :
PathPartialReconstruction@[-2] : [-1, 389, 390, 391, 392, -2]
the finished path: [-1, 389, 390, 391, 392, -2] was added to the final paths, with 235 support
FinalPath@BeforeFiltering: [-1, 389, 390, 391, 392, -2]
Grouping paths into genes
IsoformClustering, number of clusters = 0
Sep Gene IDs:{[-1, 389, 390, 391, 392, -2]=1}
FinalPath@AfterFiltering: [-1, 389, 390, 391, 392, -2]
Final Paths: 1

Final path reported: comp0_g2_i1 len=360 path=[389:0-126 390:127-137 391:138-150 392:151-359] [-1, 389, 390, 391, 392, -2]

SECTION
============= Begin Assembly ===============


Assembling subcomponent 2
Subcomponent: 2, adding pairpath: PairPath [_paths=[[393, 394, 395], []]]
Subcomponent: 2, adding pairpath: PairPath [_paths=[[394, 395], []]]
Subcomponent: 2, adding pairpath: PairPath [_paths=[[395], []]]
####  Component Read Summary BEFORE PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 393 has size: 1
Node: 393 has 1 pairpaths stored:
	PairPath [_paths=[[393, 394, 395], []]] has read support: 1

componentReadHash, start node: 394 has size: 1
Node: 394 has 1 pairpaths stored:
	PairPath [_paths=[[394, 395], []]] has read support: 15

componentReadHash, start node: 395 has size: 1
Node: 395 has 1 pairpaths stored:
	PairPath [_paths=[[395], []]] has read support: 143

## Total number of pairpaths: 3
####  Component Read Summary AFTER PairPath-per-node Reduction
*****  PairPath Counts *****
componentReadHash, start node: 393 has size: 1
Node: 393 has 1 pairpaths stored:
	PairPath [_paths=[[393, 394, 395], []]] has read support: 1

componentReadHash, start node: 394 has size: 1
Node: 394 has 1 pairpaths stored:
	PairPath [_paths=[[394, 395], []]] has read support: 15

componentReadHash, start node: 395 has size: 1
Node: 395 has 1 pairpaths stored:
	PairPath [_paths=[[395], []]] has read support: 143

## Total number of pairpaths: 3
### Extracting triplets from reads.
Setting initial triplet adjacency_path for central node: 394 => [393, 394, 395]

### 1 nodes have locked-in triplet paths:
Triplet locks for: 394 : [[393, 394, 395]]
### Extracting complex path prefixes from reads.
-capturing path prefixes
-removing prefixes that are subpaths of other prefixes
EXTENDED_TRIPLET_CAPTURED: [393, 394, 395]

#### Extended triplets from reads: 
Complex prefix paths for: 395 : [[393, 394, 395]]

SECTION
###############
## Starting Butterfly Assembly ##
###################


PairPaths to assemble:
Start Vertex:-1
PairPaths@BflyStart: PairPath [_paths=[[-1, 393], []]]=1
Start Vertex:393
PairPaths@BflyStart: PairPath [_paths=[[393, 394, 395], []]]=1
Start Vertex:394
PairPaths@BflyStart: PairPath [_paths=[[394, 395], []]]=15
Start Vertex:395
PairPaths@BflyStart: PairPath [_paths=[[395], []]]=143
PairPaths@BflyStart: PairPath [_paths=[[395, -2], []]]=1
QUEUE IS: [:W2147483647(V-1_D-1)]


#### getAllProbablePaths() The next node in the queue C is -1
	butterfly pct done: 1 / 3 = 33.333336% pct done.
ReadsStartingAtV_START_BFLY, Node: -1 read: PairPath [_paths=[[-1, 393], []]]
Exploring extension of: 1 paths that end at vertex: -1

== Current Paths Constructed Up To Vertex: -1 :
PathPartialReconstruction@[-1] : [-1]

Adding the reads {PairPath [_paths=[[-1, 393], []]]=1} to the path [-1]


################################################
###### Exploring extension of v: -1 by successor: 387
################################################


component either lacks: 387 or at sink


################################################
###### Exploring extension of v: -1 by successor: 389
################################################


component either lacks: 389 or at sink


################################################
###### Exploring extension of v: -1 by successor: 393
################################################


Count of paths ending at v: -1 = 1
path_ending_at_v: [-1]


# [PathCounter(393)=0 Examining potential extension of path ending at node V: -1 by successor: 393, via path=[-1]
path [-1] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 393], []]]
-checking if subPath has enough read support. Exploring sub path: [-1, 393]
-readsOfPathUntilV: PairPath [_paths=[[-1, 393], []]]
	-checking if pp: PairPath [_paths=[[-1, 393], []]] supports extension of [-1, 393] => true
examining subPath: [-1, 393] for reinforcement by read: [[-1, 393], []] :true
the read PairPath [_paths=[[-1, 393], []]](1) enforces the sub-path ([-1, 393])
-found: 1 reads supporting subpath.
the sub-path ([-1, 393]) has PASSED

Successful extension of 393 to generate path [-1, 393]
updateReadsOfPath: [-1, 393]
read PairPath [_paths=[[-1, 393], []]] is consistent with 393
pct_contained_propagated: 0.0%
393 was added to the queue
QUEUE IS: [GTGGTTTGATGAACCAGAACAGTC:W2(V393_361_D0)]


#### getAllProbablePaths() The next node in the queue C is 393
	butterfly pct done: 2 / 3 = 66.66667% pct done.
ReadsStartingAtV_START_BFLY, Node: 393 read: PairPath [_paths=[[393, 394, 395], []]]
Exploring extension of: 1 paths that end at vertex: 393

== Current Paths Constructed Up To Vertex: 393 :
PathPartialReconstruction@[393] : [-1, 393]

Adding the reads {PairPath [_paths=[[393, 394, 395], []]]=1} to the path [-1, 393]


################################################
###### Exploring extension of v: 393 by successor: 394
################################################


Count of paths ending at v: 393 = 1
path_ending_at_v: [-1, 393]


# [PathCounter(394)=0 Examining potential extension of path ending at node V: 393 by successor: 394, via path=[-1, 393]
path [-1, 393] is too short to check for triplet support.
ReadsOfPathUntilV: PATH: [-1, 393]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 393], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[393, 394, 395], []]]
-checking if subPath has enough read support. Exploring sub path: [-1, 393, 394]
-readsOfPathUntilV: PairPath [_paths=[[-1, 393], []]]
	-checking if pp: PairPath [_paths=[[-1, 393], []]] supports extension of [-1, 393, 394] => false
examining subPath: [-1, 393, 394] for reinforcement by read: [[-1, 393], []] :false
the read PairPath [_paths=[[-1, 393], []]](1) does not enforce the sub-path ([-1, 393, 394])
-readsOfPathUntilV: PairPath [_paths=[[393, 394, 395], []]]
	-checking if pp: PairPath [_paths=[[393, 394, 395], []]] supports extension of [-1, 393, 394] => true
examining subPath: [-1, 393, 394] for reinforcement by read: [[393, 394, 395], []] :true
the read PairPath [_paths=[[393, 394, 395], []]](1) enforces the sub-path ([-1, 393, 394])
-found: 1 reads supporting subpath.
the sub-path ([-1, 393, 394]) has PASSED

Successful extension of 394 to generate path [-1, 393, 394]
updateReadsOfPath: [-1, 393, 394]
read PairPath [_paths=[[393, 394, 395], []]] is consistent with 394
pct_contained_propagated: 50.0%
394 was added to the queue
QUEUE IS: [ATTGATATTCTTT:W17(V394_115_D1)]


#### getAllProbablePaths() The next node in the queue C is 394
	butterfly pct done: 3 / 3 = 100.0% pct done.
ReadsStartingAtV_START_BFLY, Node: 394 read: PairPath [_paths=[[394, 395], []]]
Exploring extension of: 1 paths that end at vertex: 394

== Current Paths Constructed Up To Vertex: 394 :
PathPartialReconstruction@[394] : [-1, 393, 394]

Adding the reads {PairPath [_paths=[[394, 395], []]]=15} to the path [-1, 393, 394]


################################################
###### Exploring extension of v: 394 by successor: 395
################################################


Count of paths ending at v: 394 = 1
path_ending_at_v: [-1, 393, 394]


# [PathCounter(395)=0 Examining potential extension of path ending at node V: 394 by successor: 395, via path=[-1, 393, 394]
TripletMapper doesnt contain node: 394
ReadsOfPathUntilV: PATH: [-1, 393, 394]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 393], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[394, 395], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[393, 394, 395], []]]
-checking if subPath has enough read support. Exploring sub path: [395]
-readsOfPathUntilV: PairPath [_paths=[[-1, 393], []]]
	-checking if pp: PairPath [_paths=[[-1, 393], []]] supports extension of [-1, 393, 394, 395] => false
examining subPath: [395] for reinforcement by read: [[-1, 393], []] :false
the read PairPath [_paths=[[-1, 393], []]](1) does not enforce the sub-path ([395])
-readsOfPathUntilV: PairPath [_paths=[[394, 395], []]]
	-checking if pp: PairPath [_paths=[[394, 395], []]] supports extension of [-1, 393, 394, 395] => true
examining subPath: [395] for reinforcement by read: [[394, 395], []] :true
the read PairPath [_paths=[[394, 395], []]](15) enforces the sub-path ([395])
-found: 15 reads supporting subpath.
the sub-path ([395]) has PASSED

Successful extension of 395 to generate path [-1, 393, 394, 395]
updateReadsOfPath: [-1, 393, 394, 395]
read PairPath [_paths=[[394, 395], []]] is consistent with 395
read PairPath [_paths=[[393, 394, 395], []]] is consistent with 395
pct_contained_propagated: 33.333336%
395 was added to the queue
QUEUE IS: [ATAAGCATAT...TATGCTTGTG:W20(V395_128_D2)]


#### getAllProbablePaths() The next node in the queue C is 395
	butterfly pct done: 4 / 3 = 133.33334% pct done.
ReadsStartingAtV_START_BFLY, Node: 395 read: PairPath [_paths=[[395], []]]
ReadsStartingAtV_START_BFLY, Node: 395 read: PairPath [_paths=[[395, -2], []]]
Exploring extension of: 1 paths that end at vertex: 395

== Current Paths Constructed Up To Vertex: 395 :
PathPartialReconstruction@[395] : [-1, 393, 394, 395]

Adding the reads {PairPath [_paths=[[395], []]]=143, PairPath [_paths=[[395, -2], []]]=1} to the path [-1, 393, 394, 395]


################################################
###### Exploring extension of v: 395 by successor: -2
################################################


Count of paths ending at v: 395 = 1
path_ending_at_v: [-1, 393, 394, 395]


# [PathCounter(-2)=0 Examining potential extension of path ending at node V: 395 by successor: -2, via path=[-1, 393, 394, 395]
TripletMapper doesnt contain node: 395
ReadsOfPathUntilV: PATH: [-1, 393, 394, 395]
ReadsOfPathUntiV: READ: PairPath [_paths=[[-1, 393], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[395], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[394, 395], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[395, -2], []]]
ReadsOfPathUntiV: READ: PairPath [_paths=[[393, 394, 395], []]]
-checking if subPath has enough read support. Exploring sub path: [395, -2]
-readsOfPathUntilV: PairPath [_paths=[[-1, 393], []]]
	-checking if pp: PairPath [_paths=[[-1, 393], []]] supports extension of [-1, 393, 394, 395, -2] => false
examining subPath: [395, -2] for reinforcement by read: [[-1, 393], []] :false
the read PairPath [_paths=[[-1, 393], []]](1) does not enforce the sub-path ([395, -2])
-readsOfPathUntilV: PairPath [_paths=[[395], []]]
	-checking if pp: PairPath [_paths=[[395], []]] supports extension of [-1, 393, 394, 395, -2] => false
examining subPath: [395, -2] for reinforcement by read: [[395], []] :false
the read PairPath [_paths=[[395], []]](143) does not enforce the sub-path ([395, -2])
-readsOfPathUntilV: PairPath [_paths=[[394, 395], []]]
	-checking if pp: PairPath [_paths=[[394, 395], []]] supports extension of [-1, 393, 394, 395, -2] => false
examining subPath: [395, -2] for reinforcement by read: [[394, 395], []] :false
the read PairPath [_paths=[[394, 395], []]](15) does not enforce the sub-path ([395, -2])
-readsOfPathUntilV: PairPath [_paths=[[395, -2], []]]
	-checking if pp: PairPath [_paths=[[395, -2], []]] supports extension of [-1, 393, 394, 395, -2] => true
examining subPath: [395, -2] for reinforcement by read: [[395, -2], []] :true
the read PairPath [_paths=[[395, -2], []]](1) enforces the sub-path ([395, -2])
-found: 1 reads supporting subpath.
the sub-path ([395, -2]) has PASSED

Successful extension of -2 to generate path [-1, 393, 394, 395, -2]
updateReadsOfPath: [-1, 393, 394, 395, -2]
read PairPath [_paths=[[395], []]] is consistent with -2
read PairPath [_paths=[[395, -2], []]] is consistent with -2
pct_contained_propagated: 60.000004%
-2 was added to the queue
QUEUE IS: [:W-1(V-2_D-1)]


#### getAllProbablePaths() The next node in the queue C is -2
	butterfly pct done: 5 / 3 = 166.66666% pct done.
ReadsStartingAtV_START_BFLY-2 EMPTY
Exploring extension of: 1 paths that end at vertex: -2

== Current Paths Constructed Up To Vertex: -2 :
PathPartialReconstruction@[-2] : [-1, 393, 394, 395, -2]
the finished path: [-1, 393, 394, 395, -2] was added to the final paths, with 161 support
FinalPath@BeforeFiltering: [-1, 393, 394, 395, -2]
Grouping paths into genes
IsoformClustering, number of clusters = 0
Sep Gene IDs:{[-1, 393, 394, 395, -2]=1}
FinalPath@AfterFiltering: [-1, 393, 394, 395, -2]
Final Paths: 1

Final path reported: comp0_g3_i1 len=269 path=[393:0-46 394:47-59 395:60-268] [-1, 393, 394, 395, -2]
total number of paths reported = 3 from 3 components
Done
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
   create-stamp debian/debhelper-build-stamp
 fakeroot debian/rules binary-arch
dh binary-arch --parallel --with javahelper,autoreconf
   create-stamp debian/debhelper-build-stamp
   dh_testroot -a -O--parallel
   dh_prep -a -O--parallel
   debian/rules override_dh_auto_install
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
for target in Inchworm Chrysalis trinity-plugins/*Fastool* trinity-plugins/slclust trinity-plugins/scaffold_iworm_contigs; do dh_auto_install \
	-O--sourcedirectory=${target}; done
	make -j16 install DESTDIR=/<<BUILDDIR>>/trinityrnaseq-2.2.0\+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
Making install in src
make[3]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o IRKE_run.o IRKE_run.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o IRKE.o IRKE.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o KmerCounter.o KmerCounter.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o Fasta_reader.o Fasta_reader.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
g++ -DHAVE_CONFIG_H -I. -I..   -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -fdebug-prefix-map=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
IRKE_run.cpp:9:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
Fasta_reader.cpp:5:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'Fasta_reader.o' failed
make[3]: *** [Fasta_reader.o] Error 1
make[3]: *** Waiting for unfinished jobs....
fastaToKmerCoverageStats.cpp:13:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
FastaToDeBruijn.cpp:18:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
IRKE.cpp:14:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
Makefile:431: recipe for target 'FastaToDeBruijn.o' failed
make[3]: *** [FastaToDeBruijn.o] Error 1
1 error generated.
KmerCounter.cpp:11:10: fatal error: 'omp.h' file not found
#include <omp.h>
         ^
1 error generated.
Makefile:431: recipe for target 'IRKE_run.o' failed
make[3]: *** [IRKE_run.o] Error 1
Makefile:431: recipe for target 'fastaToKmerCoverageStats.o' failed
make[3]: *** [fastaToKmerCoverageStats.o] Error 1
1 error generated.
Makefile:431: recipe for target 'KmerCounter.o' failed
make[3]: *** [KmerCounter.o] Error 1
1 error generated.
Makefile:431: recipe for target 'IRKE.o' failed
make[3]: *** [IRKE.o] Error 1
make[3]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm/src'
Makefile:349: recipe for target 'install-recursive' failed
make[2]: *** [install-recursive] Error 1
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/Inchworm'
dh_auto_install: make -j16 install DESTDIR=/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no returned exit code 2
	make -j16 install DESTDIR=/<<BUILDDIR>>/trinityrnaseq-2.2.0\+dfsg/debian/tmp AM_UPDATE_INFO_DIR=no
make[2]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
X=`pwd`; \
for i in src; \
do echo '<<<' $i '>>>'; cd $X/$i; make install; done
<<< src >>>
make[3]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
mv slclust ../bin/
make[3]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust/src'
make[2]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg/trinity-plugins/slclust'
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
   debian/rules override_dh_install-arch
make[1]: Entering directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
dh_install -a
dh_install: Cannot find (any matches for) "Chrysalis/TranscriptomeFromVaryK" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/TranscriptomeFromVaryK
dh_install: Cannot find (any matches for) "Chrysalis/RunButterfly" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/RunButterfly
dh_install: Cannot find (any matches for) "Chrysalis/ReadsToTranscripts_MPI_chang" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/ReadsToTranscripts_MPI_chang
dh_install: Cannot find (any matches for) "Chrysalis/ReadsToTranscripts_MPI" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/ReadsToTranscripts_MPI
dh_install: Cannot find (any matches for) "Chrysalis/ReadsToTranscripts" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/ReadsToTranscripts
dh_install: Cannot find (any matches for) "Chrysalis/QuantifyGraph" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/QuantifyGraph
dh_install: Cannot find (any matches for) "Chrysalis/JoinTransByPairs" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/JoinTransByPairs
dh_install: Cannot find (any matches for) "Chrysalis/IsoformAugment" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/IsoformAugment
dh_install: Cannot find (any matches for) "Chrysalis/GraphFromFasta_MPI" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/GraphFromFasta_MPI
dh_install: Cannot find (any matches for) "Chrysalis/GraphFromFasta" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/GraphFromFasta
dh_install: Cannot find (any matches for) "Chrysalis/CreateIwormFastaBundle" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/CreateIwormFastaBundle
dh_install: Cannot find (any matches for) "Chrysalis/Chrysalis" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/Chrysalis
dh_install: Cannot find (any matches for) "Chrysalis/BreakTransByPairs" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: Chrysalis/BreakTransByPairs
dh_install: Cannot find (any matches for) "debian/tmp/usr/lib/trinityrnaseq/Inchworm" (tried in ., debian/tmp)

dh_install: trinityrnaseq missing files: debian/tmp/usr/lib/trinityrnaseq/Inchworm
dh_install: missing files, aborting
debian/rules:47: recipe for target 'override_dh_install-arch' failed
make[1]: *** [override_dh_install-arch] Error 25
make[1]: Leaving directory '/<<BUILDDIR>>/trinityrnaseq-2.2.0+dfsg'
debian/rules:20: recipe for target 'binary-arch' failed
make: *** [binary-arch] Error 2
dpkg-buildpackage: error: fakeroot debian/rules binary-arch gave error exit status 2
--------------------------------------------------------------------------------
Build finished at 2017-07-06T17:42:29Z

Finished
--------


+------------------------------------------------------------------------------+
| Cleanup                                                                      |
+------------------------------------------------------------------------------+

Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
E: Build failure (dpkg-buildpackage died)

+------------------------------------------------------------------------------+
| Summary                                                                      |
+------------------------------------------------------------------------------+

Build Architecture: amd64
Build Type: any
Build-Space: 222616
Build-Time: 19
Distribution: unstable
Fail-Stage: build
Host Architecture: amd64
Install-Time: 26
Job: trinityrnaseq_2.2.0+dfsg-2
Machine Architecture: amd64
Package: trinityrnaseq
Package-Time: 71
Source-Version: 2.2.0+dfsg-2
Space: 222616
Status: attempted
Version: 2.2.0+dfsg-2
--------------------------------------------------------------------------------
Finished at 2017-07-06T17:42:29Z
Build needed 00:01:11, 222616k disk space
E: Build failure (dpkg-buildpackage died)
DC-Status: Failed 72.002040033s
DC-Time-Estimation: 72.002040033 versus expected 986 (r/m: 12.694056439902205 ; m: 72.002040033)